Development 122, 1291-1302 (1996)
Printed in Great Britain © The Company of Biologists Limited 1996
DEV4613
1291
A cell- and developmental stage-specific promoter drives the expression of a
truncated c-kit protein during mouse spermatid elongation
Cristina Albanesi1, Raffaele Geremia1, Marco Giorgio2, Susanna Dolci1, Claudio Sette1,
and Pellegrino Rossi1,*
1Dipartimento
di Sanita’ Pubblica e Biologia Cellulare, Universita’ di Roma “Tor Vergata”, and 2Dipartimento di Biopatologia
Umana, Universita’ di Roma “La Sapienza”, Rome, Italy
*Author for correspondence (e-mail: [email protected])
SUMMARY
In the postnatal testis, the c-kit transmembrane tyrosinekinase receptor is expressed in type A spermatogonia, and
its transcription ceases at the meiotic phase of spermatogenesis. Alternative, shorter c-kit transcripts are expressed
in post-meiotic germ cells. These transcripts should encode
a truncated version of the c-kit protein, lacking the extracellular, the transmembrane and part of the intracellular
tyrosine-kinase domains. The 5′ end of the alternative c-kit
transcripts maps within an intron of the mouse c-kit gene.
We now show that this intron contains a promoter active
in nuclear extracts of round spermatids, and that two
discrete sequences upstream of the transcriptional start site
bind spermatid-specific nuclear factors. Deletion of both
these sequences abolishes activity of the promoter in vitro.
We have also established that this promoter is functional
in vivo, in a tissue- and cell-specific fashion, since intronic
sequences drive the expression of the E. coli lacZ reporter
gene in transgenic mice specifically in the testis. Transgene
expression is confined to haploid germ cells of seminiferous
tubules, starting from spermatids at step 9, and disappearing at step 13, indicating that a cryptic promoter
within the 16th intron of the mouse c-kit gene is active in a
short temporal window at the end of the transcriptional
phase of spermiogenesis. In agreement with these data,
western blot experiments using an antibody directed
against the carboxy-terminal portion of the mouse c-kit
protein showed that a polypeptide, of the size predicted by
the open reading frame of the spermatid-specific c-kit
cDNA, accumulates in the latest stages of spermatogenesis
and in epididymal spermatozoa. An immunoreactive
protein of the same size can be produced in both eukaryotic and prokaryotic artificial expression systems.
INTRODUCTION
ulation (Rossi et al., 1991, 1993b). After birth, the soluble form
of the ligand stimulates DNA synthesis selectively in type A
spermatogonia (Rossi et al., 1993b). The relevance of c-kit in
male gametogenesis after birth has been also established in
vivo (Yoshinaga et al., 1991; Brinster and Avarbock, 1994).
In the meiotic phase of spermatogenesis c-kit expression
ceases, but in the subsequent haploid phase alternative shorter
transcripts are present (Sorrentino et al., 1991). These transcripts should encode a truncated form of the receptor, with a
predicted molecular mass of approx. 23 ×103, in which only
the second box of the split kinase is present, whereas the extracellular and transmembrane domain, and the first box of the
split kinase domain, are missing (Rossi et al., 1992). The 5′
end of the alternative c-kit transcripts maps within an intron
that separates the exon encoding the interkinase domain from
the first exon encoding the phosphotransferase domain (Rossi
et al., 1992). According to the published structure of the murine
c-kit gene (Gokkel et al., 1992), these sequences correspond to
the 16th intron.
During the haploid phase of spermatogenesis, together with
the expression of germ cell-specific genes with a known
In both W and Sl mutant mice, one major symptom, together
with anemia and pigmentation defects, is sterility (Russell,
1979). W locus encodes the c-kit transmembrane receptor
tyrosine-kinase (Chabot et al., 1988). The c-kit receptor is a
protein of approx. 150×103 Mr consisting of an immunoglobulin-like extracellular domain, a transmembrane domain, and
an intracellular tyrosine kinase domain, characteristically split
by an intervening protein sequence into an ATP-binding site
and a phosphotransferase catalytic site (Qiu et al., 1988). c-kit
mRNA is expressed in primordial germ cells of the embryonal
gonad (Manova and Bachvarova, 1991), and it is also
expressed, at high levels, in type A spermatogonia of the postnatal testis (Sorrentino et al., 1991).
The Sl locus encodes the c-kit ligand (Besmer, 1991), which
can exist in either a soluble or a transmembrane form
(Flanagan et al., 1991). Both forms of the c-kit ligand are
essential for survival of primordial germ cells in culture (Dolci
et al., 1991; Godin et al., 1991), and are expressed in the
postnatal testis by Sertoli cells under cAMP and/or FSH stim-
Key words: c-kit, spermatogenesis, haploid-specific transcription,
tyrosine-kinase-independent function, cell-specific promoter,
transgenic mice
1292 C. Albanesi and others
function, such as protamine (for a review, see Hecht, 1990) or
PGK2 (McCarrey and Thomas, 1987), a peculiar pattern of
expression of additional genes with no obvious function is
observed. In many cases, expression of RNA transcripts has
not been accompanied by demonstration of the presence of the
corresponding protein products. This pattern ranges from
expression of regulatory genes normally involved in
embryonal development, such as Hoxa-4 (Behringer et al.,
1993) or Sry (Rossi et al., 1993a), to the presence of alternative transcripts for genes normally expressed in somatic cells.
These alternative transcripts are generated either by utilization
of alternative promoters, such as in the case of ACE (Langford
et al., 1991), or by alternative splicing of precursor RNAs, as
in the case of many protooncogenes (Propst et al., 1988; Sorrentino et al., 1988).
In order to establish the function of the alternative c-kit gene
products in the haploid phase of spermatogenesis, in the
present work, as an initial approach, we have addressed two
major questions: (1) whether a transcriptional promoter specifically activated during spermiogenesis is present within the
16th intron of the mouse c-kit gene; and (2) whether the
truncated c-kit mRNAs are translated into the predicted
polypeptide. We show that a testis-specific promoter is actually
present within the 16th intron of the murine c-kit gene, and that
this promoter is specifically active in a short temporal window
during spermiogenesis. Moreover, we show that this intronic
promoter is responsible for the accumulation in elongating
spermatids and epididymal spermatozoa of a truncated c-kit
protein of the size predicted through molecular cloning of the
alternative c-kit transcripts.
MATERIALS AND METHODS
subcloning a 1.16 kb SalI/BamHI fragment from p-kit-int (containing
sequences between −623 and +526 with respect to the presumptive
spermatid-specific transcriptional start site). After addition of
synthetic BamHI-XhoI adaptors, the fragment was cloned in the XhoI
site of plasmid pNASSβ (Clontech), in the direct orientation in front
of the E. coli lacZ gene. All constructs were made by using standard
recombinant methods (Sambrook et al., 1989). Synthetic oligonucleotides utilized in DNA binding experiments and PCR analysis were
produced through standard techniques with a 391 DNA synthesizer
(PCR-MATE EP; Applied Biosystems-Perkin Elmer).
In vitro transcription
Nuclear extracts from purified testicular cells were prepared as previously described (Bunick et al., 1990), with modifications. Pellets
from freshly prepared cells were resuspended in two volumes of a
homogenization buffer containing 25 mM KCl, 10 mM Hepes, pH
7.6, 1 mM EDTA, 0.5 mM dithiothreitol, 10% (v/v) glycerol, 0.5 mM
phenylmethylsulphonylfluoride (PMSF), 10 µg/ml pepstatin A and 10
µg/ml antipain. After homogenization with 40 strokes in a glass
Dounce homogenizer, nuclei were pelleted by centrifugation and
washed with two volumes of nuclei buffer, containing 10 mM Hepes
pH 7.9, 1.5 mM MgCl2, 0.1 mM EDTA, 0.5 mM dithiothreitol, 10%
(v/v) glycerol, 0.5 mM PMSF, 10 µg/ml pepstatin A and 10 µg/ml
antipain. Nuclei were resuspended in 2.2 volumes of nuclei buffer
with the addition of KCl to a final concentration of 0.3 M. Samples
were gently rocked for 1 hour at 4°C, and then clarified by centrifugation at 100,000 g for 30 minutes. Supernatants were diluted with
two volumes of nuclei buffer and concentrated through Centricon-10
(Amicon) to reach a final volume of about one half of the original
volume of the nuclear pellet (protein concentration 10-15 mg/ml),
dispensed into samples and stored at −75°C. Run-off transcription
reactions were performed for 60 minutes at 25°C using 10 µl of
nuclear extracts, 1 µl of a 1 µg/µl linearized plasmid DNA template,
10 µl of a buffer containing 14% glycerol, 20 mM KCl, 6.5 mM
MgCl2, 14 mM Hepes pH 7.9, 1.2 mM of each ATP, CTP and UTP,
0.05 mM GTP, 0.5 µl RNAsin (60 U/µl, Amersham), 0.5 µl [α32P]GTP (Amersham, 400 Ci/mmol, 10 mCi/ml). Reactions were
stopped with 380 µl of a buffer containing 50 mM Tris-HCl, pH 7.5,
1% SDS, 5 mM EDTA and 25 µg/ml tRNA, extracted twice with
phenol-chloroform, precipitated, dessiccated and electrophoresed on
4% acrylamide gels containing 7 M urea.
Testicular cell preparation
Spermatogonia from 7- to 8-day old mice and primary Sertoli cellenriched cultures from 18-day old mice were prepared as previously
described (Rossi et al., 1993b). Germ cell-Sertoli cell cocultures were
prepared from 13-day old mice using the same procedure that was
utilized to obtain Sertoli cell-enriched monolayers, but omitting the
hypotonic treatment, which selectively eliminates germ cells. Germ
cells at pachytene spermatocyte, round spermatid and elongating
spermatid steps were obtained by elutriation of unfractionated suspensions of germ cells from testes of adult mice, as previously
described for the rat (Meistrich, 1977). Homogeneity of cell populations ranged between 90% (pachytene spermatocytes) and more than
95% (spermatids at various steps of differentiation), and was routinely
controlled morphologically. To obtain spermatozoa, cauda epididymis
of adult mice were squeezed using a syringe needle. Spermatozoa
were allowed to disperse for 30 minutes at 37°C in Minimum
Essential Medium Eagle’s supplemented with 2 mM sodium lactate,
1 mM sodium pyruvate and 1 mg/ml bovine serum albumin (BSA)
under a 5% CO2 atmosphere, and collected by centrifugation.
DNA binding assays
Nuclear extracts (protein concentration approx. 15 mg/ml) from testicular cells for DNA binding assays were prepared as previously
described (Grimaldi et al., 1993). DNA restriction fragments for electrophoretic mobility shift assays (EMSA) were labeled at the 5′ end
with [γ-32P]ATP using sequential alkaline phosphatase and T4
polynucleotide kinase treatment, whereas synthetic oligonucleotides
for both EMSA experiments and southwestern analysis were filled-in
with [α-32P]dATP and Klenow enzyme (Sambrook et al., 1989).
Labeled restriction fragments were purified by non-denaturing polyacrylamide gel electrophoresis, whereas labeled oligonucleotides
were purified by gel filtration on Sephadex G50. Conditions utilized
for EMSA and southwestern experiments have been described previously (Grimaldi et al., 1993).
DNA constructions for in vitro transcription and
transgenic analysis
Plasmid p-kit-int was constructed by subcloning in the SmaI site of
pBluescript KS M13+ (Stratagene) a PCR-amplified 1161 bp genomic
fragment from the mouse c-kit gene. This fragment contains the last
47 bp from the 16th exon, the entire 16th intron, and the first 87 bp
from the 17th exon. These sequences span from −623 to +538, with
respect to the presumptive transcriptional start site utilized for the
generation of the alternative c-kit transcripts expressed in round spermatids (Rossi et al., 1992). Plasmid p-kit-int-Gal was constructed by
Generation and identification of transgenic mice
A 5 kb PstI restriction fragment from plasmid p-kit-int-Gal, containing the 16th intron of the mouse c-kit gene linked to the E. coli lacZ
gene, was purified by electroelution and microinjected into male
pronuclei of one-cell (C57/6J×DBA/2)F2 mouse zygotes. Transgenic
mice were produced by standard techniques (Brinster et al., 1985).
Identification of transgenic animals was performed by standard
Southern blot analysis (Sambrook et al., 1989) of tail DNA digested
with EcoRI, using as a probe a 3 kb EcoRI-SacI fragment from
plasmid p-kit-int-Gal labeled with [α-32P]dATP by random priming
Intronic c-kit promoter active in spermatids 1293
(Boehringer). This probe detects a 5 kb band corresponding to the
transgene, and a 2 kb band from the endogenous c-kit gene. Verification of heterozygosity or homozygosity for the transgene was
performed by PCR analysis of genomic DNA from the offspring of
the transgenic animals mated with non-transgenic partners. The E. coli
lacZ gene was detected with GCATCGAGCTGGGTAATAAGGGTTGGCAAT and GACACCAGACCAACTGGTAATGGTAGCGAC
(amplifying a 822 bp fragment), and the endogenous RapSyn gene
with AGGACTGGGTGGCTTCCAACTCCCAGACAC and AGCTTCTCATTGCTGCGCGCCAGGTTCAGG (amplifying a 590 bp
fragment).
Analysis of lacZ protein (β-galactosidase) and RNA
expression
Fresh tissues were fixed for 2 hours at 4°C in 0.1 M phosphate buffer,
pH 7.3, 0.01% sodium deoxycholate, 0.02% Nonidet-P40, 0.2% glutaraldehyde and 2% formaldehyde. β-galactosidase staining was
performed, after three rinses at room temperature in 0.1 M phosphate
buffer, by overnight immersion of tissues at 37°C in 0.1 M sodium
phosphate pH 7.3, 1.3 mM MgCl2, 5 mM K3Fe(CN)6, 5 mM
K4Fe(CN)6, 1 mg/ml X-gal (Sigma). After a brief rinsing with 0.1 M
phosphate buffer, pH 7.3, tissues were prepared for sectioning in
frozen blocks of OCT (Tissue Tek). 30 µm cryostatic sections were
washed with 0.1 M phosphate buffer, pH 7.3, dehydrated with ethanol
and mounted with Eukitt (Kindler Gmbh). Alternatively, seminiferous tubules were isolated mechanically in PBS, layered on a slide,
covered with a coverslip and directly observed through transillumination. For more detailed morphological analysis of stage-specific
expression, after β-galactosidase staining, tissues were fixed again in
buffered formalin, and paraffin-embedded. 5 µm sections were
prepared, stained with PAS and counterstained with hematoxylin.
Total RNAs for northern blot analysis were prepared by homogenization in a Dounce glass homogenizer of frozen tissues with
RNAzol (Biotecx Laboratories). Equal amounts of RNA from each
sample were electrophoresed through denaturing agarose gels and
transferred to Hybond-N membranes (Amersham). Blots were
hybridized with a 2.2 kb SacI fragment from plasmid pNASSβ
(Clontech), containing sequences from the E. coli lacZ gene, which
had been labeled with [α-32P]dATP by random priming (Boehringer).
Blots were washed under highly stringent conditions (Sambrook et
al., 1989) and subjected to autoradiography at −75°C with intensifier
screens for 60 hours.
Immunofluorescence and western blot analysis
Polyclonal antibodies were raised in rabbits using a synthetic peptide
corresponding to the last 13 amino acids encoded by the mouse c-kit
open reading frame (ORF): Ala-Ser-Ser-Thr-Gln-Pro-Leu-Leu-ValHis-Glu-Asp-Ala.
For immunofluorescence experiments, Sertoli cell-mitotic germ
cell cocultures were performed on sterile glass coverslips, whereas
germ cell suspensions in advanced stages of spermatogenesis were
spotted on glass slides previously treated with poly-L-lysine. Samples
were fixed for 15 minutes at room temperature with 4% paraformaldehyde in phosphate-buffered saline (PBS), and treated with 0.1%
Triton X-100 in PBS for a further 15 minutes. Slides were dipped in
a blocking solution containing 0.5% BSA in PBS overnight at 4°C.
Samples were then incubated at 37°C for 1 hour with protein ASepharose affinity-purified preimmune or immune IgG fractions (10
mg/ml stock solutions) that had been diluted 1:100 in PBS containing 0.5% BSA. After three washes for 5 minutes at room temperature
in the same buffer, samples were incubated for 30 minutes at 37°C
with a goat anti-rabbit IgG polyclonal antibody conjugated with
rhodamine (Calbiochem), diluted 1:75. After two 5 minute washes at
room temperature, slides were mounted with 50% glycerol in PBS.
For western blot analysis, frozen pellets of germ cells at different
stages of spermatogenesis and epididymal spermatozoa were directly
resuspended in SDS-PAGE sample buffer, homogenized first in a
glass Dounce homogenizer, and then sheared through an insulin
syringe. After boiling for 5 minutes, samples containing similar
amount of proteins were electrophoresed on 13% SDS-polyacrylamide gels. Proteins from gels were transferred to Hybond-C nitrocellulose membranes (Amersham) overnight at 4°C. Filters were
blocked for 1 hour at room temperature with a buffer containing 10%
non-fat dry milk, 0.1% Tween-20 in PBS, and then incubated for 1
hour at room temperature in a solution of total preimmune or immune
serum diluted 1:200 in the same buffer. Filters were developed with
a second anti-rabbit IgG antibody conjugated with peroxidase
(1:20,000), using the ECL immunodetection system (Amersham)
followed by autoradiography, according to the manufacturer’s instructions.
Expression of the truncated c-kit protein in COS cells and
in E. coli
For eukaryotic expression, a 1.8 kb HindIII fragment from plasmid
pSTK3b, containing part of the 5′ and 3′ untranslated regions and the
entire ORF of spermatid-specific c-kit cDNA clone 3b (Rossi et al.,
1992), was subcloned in the pCMV5 expression vector, in the direct
orientation downstream from the cytomegalovirus promoter. For
protein expression, subconfluent cultures of COS cells were transfected using the standard CaPO4 coprecipitation method (Gorman et
al., 1982) with 20 µg of PCMV5-c-kit hybrid construct, for 5 hours
at 37°C. At the end of the incubation cells were shocked for 2 minutes
with 10% glycerol in growth medium, rinsed twice with PBS, and
grown for an additional 24 hours. Cells were then harvested and lysed
in 50 mM Hepes, pH 7.4, 150 mM NaCl, 1.5 mM MgCl2, 1 mM
EGTA, 10% glycerol, 1% Triton X-100, 50 mM benzamydine, 0.5
µg/ml leupeptin, 0.7 µg/ml pepstatin, 4 µg/ml aprotinin and 2 mM
PMSF. Cell extracts were centrifuged for 10 minutes at 15,000 g. The
resulting supernatants were analyzed by SDS-PAGE and western
blotting.
For prokaryotic expression, the ORF deduced from the spermatidspecific c-kit cDNA (Rossi et al., 1992) was amplified by RT-PCR
and subcloned into a pQE-60 expression vector. E. coli strain M15
was used for transformation. Selection was performed with
kanamycin and ampicillin. For protein expression, positive colonies
or wild-type bacteria were grown to OD595nm=0.8. Growth was
continued for a further 3 hours in the absence or presence of 2 mM
IPTG. Cells were collected by centrifugation and lysed by sonication.
The bacterial lysates were analyzed by SDS-PAGE and western blot
analysis.
RESULTS
Identification of a presumptive promoter for the
expression of the truncated c-kit
In vitro run-off transcription experiments, using nuclear
extracts from round spermatids (Fig. 1), suggested that the
alternative c-kit transcripts during spermiogenesis are
generated by a cryptic promoter present within the 16th intron
of the mouse c-kit gene. We used nuclear extracts from mouse
round spermatids (steps 1-9 of spermiogenesis) and, as a
template for in vitro RNA synthesis, plasmid p-kit-int, containing sequences between −622 and +538, with respect to the
presumptive transcriptional start site utilized in spermatids.
The plasmid had been digested with restriction enzymes, which
cut at different distances downstream from the presumptive
transcriptional (CAP) site. Three labeled RNA fragments were
generated, of 540 (BamHI), 700 (PvuII) and 730 (BglI)
nucleotides (n.) respectively, as expected if transcription
started at the predicted point. Transcription is RNA polymerase
II-dependent, since it is completely abolished by using α-
1294 C. Albanesi and others
Fig. 2. Nuclear factors
present in meiotic and
postmeiotic germ cells,
but not in Sertoli cells,
bind sequences within
the 16th intron of the
mouse c-kit gene.
EMSA experiments
with increasing
concentrations of
nuclear extracts from
purified testicular cells,
using as a probe a PstIXbaI fragment from
plasmid p-kit-int,
containing sequences
from −623 to −289
from the presumptive
spermatid-specific c-kit
transcriptional start site.
Fig. 1. Sequences within the 16th intron of the mouse c-kit gene act
as a transcriptional promoter in vitro. Run-off transcription
experiments using nuclear extracts from mouse round spermatids
(steps 1-9 of spermiogenesis) in the presence of labeled
ribonucleotide precursors, using as a template for in vitro RNA
synthesis plasmid p-kit-int, which is schematically shown on the
right side of the picture. Restriction enzymes used to linearize the
template, and the position of the presumptive spermatid-specific
transcriptional (CAP) site present within the c-kit genomic
sequences, are indicated. Arrows on the left side of the
autoradiograph indicate the RNA bands of expected size, as
schematically represented by thick bars adjacent to the scheme.
Other bands represent aspecific transcription starting from the M13
F1 intergenic region, indicated by thin bars adjacent to the scheme,
or products derived from premature termination or degradation.
Transcription is RNA polymerase II-dependent, since it is
completely abolished by using as a specific inhibitor α-amanitin (+
lanes).
amanitin as a specific inhibitor. Using as a template intronic
sequences placed in different vectors, we obtained similar
results with nuclear extracts from round spermatids, whereas
no specific in vitro transcription products were generated with
nuclear extracts from Sertoli cells or pachytene spermatocytes
(data not shown).
The presumptive promoter has binding sites for
spermatid-specific nuclear proteins
DNA-binding experiments show that nuclear factors present in
extracts from spermatids and from spermatocytes, but not from
Sertoli cells, bind to c-kit intronic sequences between −622 and
−289 from the presumptive CAP site (Fig. 2). However, specific
DNA-protein complexes were observed only with round
spermatid nuclear extracts when adding 8 µg of protein, and the
electrophoretic mobility of DNA-protein complexes formed
with meiotic germ cells was different from that observed in
postmeiotic germ cells at any tested concentration of nuclear
extracts, suggesting that haploid cell-specific nuclear factors
were present in these extracts. Fig. 3 schematically shows that,
using EMSA experiments with 8 µg of protein, we have been
able to map two small regions within this presumptive
promoter, which are essential for binding of spermatid-specific
nuclear factors: a 82 bp sequence at position −485/−404, and a
19 bp sequence between −68/−50 from the presumptive transcriptional start site. EMSA experiments using as probes an
oligonucleotide spanning from −471 to −437, or another
oligonucleotide spanning from −456 to −423 (Fig. 4), show that
only the −471/−437 oligonucleotide was able efficiently to form
specific DNA-protein complexes. In the −464/−456 area a
perfect ‘enhancer core’ element (GTGTGGTAA) is found. The
‘enhancer core’ element can bind transcription factors such as
AP-3 and C/EBP (Faisst and Meyer, 1992), and the importance
of these sequences is strengthened by the observation that
formation of the complex can be inhibited in the presence of a
SV40 enhancer fragment, which contains a similar sequence
element. Fig. 5 shows that the −471/−437 oligonucleotide, but
not an unrelated oligonucleotide, recognizes in southwestern
experiments a series of polypeptides present in nuclear extracts
from round spermatids, but not from spermatocytes or Sertoli
cells.
Deletion of the two binding sites for spermatidspecific nuclear proteins abolishes in vitro
transcription from the presumptive intronic c-kit
promoter
We performed progressive deletions 5′ with respect to the
spermatid-specific CAP site within the 16th c-kit intron in
plasmid p-kit-int, and we tested these templates in in vitro runoff transcription experiments with nuclear extracts from round
spermatids, after linearization with PvuII (Fig. 6). A specific
700 n. RNA band indicates correct transcriptional initiation
from the presumptive CAP site. Deletion up to −460, just
within the ‘enhancer core’ element, provokes a twofold
reduction in the intensity of the 700 n. specific RNA band, and
a threefold reduction is achieved with a deletion up to −404,
which completely removes the first of the two regions essential
Intronic c-kit promoter active in spermatids 1295
Fig. 4. Spermatid-specific nuclear factor/s binding between −471 and
−456 from the presumptive spermatid-specific c-kit transcriptional
start site recognize an enhancer core element. EMSA experiments
with nuclear extracts from round spermatids using as probes
synthetic oligonucleotides. Sequences within the 16th intron of the ckit gene in the region between −471 and −423 from the presumptive
spermatid-specific transcriptional start site are shown above, with the
oligonucleotides used indicated. The ‘enhancer core’ (potential AP3
binding site) between −464 and −456 is boxed. Molar excess of
competitors was 100-fold. The SV40 enhancer fragment used as a
competitor is a 72 bp SphI restriction fragment from plasmid
PSV2CAT (Gorman et al., 1982).
Fig. 3. Discrete sequences within the 16th intron of the mouse c-kit
gene specifically bind nuclear factors present in round spermatids.
The top scheme represents a summary of the results of EMSA
experiments with 8 µg of nuclear extracts from mouse round
spermatids (steps 1-9 of spermiogenesis) using as probes several
labeled restriction fragments of the DNA region spanning the 16th
intron of the mouse c-kit gene (indicated by bars). The restriction
map of the intron is shown above the scheme, whereas a schematic
representation of the two areas which are critical for specific binding
of nuclear factors is drawn below. CAP site indicates the
presumptive start of transcription of the truncated c-kit mRNAs
expressed during mouse spermiogenesis. Restriction fragments
numbered in the scheme correspond to those utilized in the
representative example of EMSA experiments, whose
autoradiograph is shown at the bottom of the figure.
for binding of spermatid-specific nuclear factors (see Fig. 3).
Even though the area between −404 and −68 does not contain
major binding sites for spermatid-specific nuclear factors (see
Fig. 3), at least in the conditions of gel-shift analysis that we
used, a further reduction of run-off transcription is obtained
with a deletion up to −313, suggesting that other sequences in
this area contribute to overall specific transcription. Deletion
up to −50 completely abolishes correct transcriptional
initiation of the 700 n. specific RNA band, indicating that the
Fig. 5. Multiple factors
present in nuclear extracts
from round spermatids,
but not from pachytene
spermatocytes (P.Sc.) nor
from Sertoli cells (S.C.),
are specifically
recognized by sequences
between −471 and −437
from the presumptive
spermatid-specific
transcriptional start site.
Southwestern
experiments with the
indicated amounts of
nuclear extracts from
different testicular cell
types, used as a probe
oligonucleotide 1,
indicated in Fig. 4, or an
unrelated oligonucleotide
of the same size
containing a random
sequence (control).
−68/−50 region, essential for binding of spermatid-specific
nuclear factors (see Fig. 3), is required for the full functionality of the intronic c-kit promoter in haploid germ cells. This
1296 C. Albanesi and others
Fig. 6. Deletion of the two binding sites for spermatid-specific
nuclear proteins completely abolishes in vitro transcription from the
presumptive intronic c-kit promoter. Autoradiograph of run-off
transcription experiments using nuclear extracts from round
spermatids (steps 1-9 of spermiogenesis) in the presence of labeled
ribonucleotide precursors, using as a template for in vitro RNA
synthesis plasmid p-kit-int linearized with PvuII, or the same
template with the indicated progressive deletions 5′ with respect to
the presumptive transcriptional start site, obtained with the indicated
restriction enzymes. S.D. and S.A. indicate splice donor and acceptor
sites, respectively.
region contains the sequence TGAAAGTG, which is present
in the binding site of transcription factors IRF-1, IRF-2
(Tanaka et al., 1993) and PRDI-BF1 (Keller and Maniatis,
1991), which are involved in the regulation of interferons and
interferon-regulated genes. We also found that deletion of 400
bp at the 3′ end of the intronic sequence (from +138 to +538)
resulted in generation of the predicted RNA bands with nuclear
extracts of round spermatids (data not shown). Thus deletion
analysis suggests that sequences between −464 and −50 from
the presumptive CAP site are required for efficient transcription of the alternative c-kit mRNA in spermatids.
The intronic c-kit promoter is active in spermatids of
transgenic mice in seminiferous tubules at stages
IX-XI
The observation that spermatid-specific nuclear proteins
specifically recognize two discrete sequence elements within
the 16th intron of the mouse c-kit gene, upstream from the presumptive transcriptional start site, and that deletion of both
these sequences abolishes in vitro transcription with spermatid
nuclear extracts, strongly supports the hypothesis that a
promoter specifically activated in the haploid phase of spermatogenesis is present within this intron.
In order to confirm in vivo the activity of the intronic
promoter, we have generated five independent lines of transgenic mice in which approx. 1.1 kb of these sequences (from
−622 to +538 with respect to the presumptive CAP site) are
linked to the reporter E. coli lacZ gene (Fig. 7). The transgene
was correctly integrated into the mouse genome and transmitted in a Mendelian fashion. Selective expression of the
transgene in the testis was observed through northern blot
Fig. 7. Schematic representation of recombinant p-kit-int-Gal
plasmid used for generation of transgenic mice. Mouse c-kit
sequences between −623 and +538 from the presumptive spermatidspecific transcriptional start site within the 16th intron were placed 5′
to the E. coli lacZ gene in plasmid pNASSβ, containing SV40 splice
signals (small T intron) 5′ with respect to lacZ, and SV40
polyadenylation signals at the 3′ end of the reporter gene. A 5 kb
restriction fragment between the two PstI sites was used for
microinjection of mouse one-cell stage zygotes, whereas a 3 kb
fragment between EcoRI and SacI was used as a probe in Southern
blot analysis of tail DNA for identification of transgenic animals.
analysis. Fig. 8 shows that strong RNA signals of the predicted
size were observed in the testis of most members of the ‘blue’
and ‘orange’ families. Expression of the lacZ gene in the testis
was evident at the RNA level, even though the signal was of
lower intensity, also in members of the ‘violet’ and ‘green’
lines. Members of the ‘red’ family did not show any detectable
lacZ RNA signal. RNA signals in the four expressing families
were of the predicted size (approx. 4.0 kb, including approx.
0.5 kb of c-kit sequences and approx. 3.4 kb of lacZ
sequences), indicating that the CAP site of the endogenous
gene, utilized for generation of the spermatid-specific c-kit
transcripts both in vivo (Rossi et al. 1992) and in vitro (see Fig.
1 and 6), corresponds to the transcriptional start site within the
transgene. The less intense RNA smears of larger and smaller
size probably represent different degrees of polyadenylation
and/or incomplete removal of the SV40 small T intron
sequences (see Fig. 7).
Histochemical analysis revealed that β-galactosidase activity
in the testis was specifically expressed inside seminiferous
tubules, within the cytoplasm of haploid germ cells (Fig. 9).
Transillumination analysis clearly indicated that specific βgalactosidase staining was much more evident in some areas of
the seminiferous tubules than in others, thus suggesting a stagespecific expression of this promoter (Fig. 9, top). This interpretation was confirmed through the analysis of frozen sections,
in which positivity was very evident in some seminiferous
tubules, whereas in other tubules lacZ activity was less intense
or absent (Fig. 9, bottom). Accurate analysis of paraffinembedded sections (Fig. 10) indicated that specific β-galactosidase staining was evident in haploid germ cells starting at stage
IX, when spermiation has just occurred and round spermatids
at steps 8-9 of spermiogenesis cease their transcriptional
Intronic c-kit promoter active in spermatids 1297
Fig. 8. Four out of five families of transgenic mice
express E. coli lacZ RNA under the control of the 16th
intron of the mouse c-kit gene specifically in the testis.
Northern blot analysis of 15 µg of total RNAs from testis
and/or other indicated tissues of wild-type (WT) and
transgenic mice from the five different lines (‘blue’,
‘orange’, ‘violet’, ‘green’, and ‘red’) that we established.
Additional members of the ‘orange’ family are indicated
by asterisks. The generation of transgenic animals (F2, F3,
or F4) is indicated. RNA samples were similar for both
quality and quantity, as judged after ethidium bromide
staining before blotting, by evaluating the intensity of the
28 S and 18 S ribosomal RNA bands. Blots were
hybridized using as a probe a fragment of the E. coli lacZ
gene (see Materials and methods).
activity. Positivity progressively moved toward the lumen of the
seminiferous tubules: it was clearly evident in stage X and XI,
and it declined in stage XII. In stage I some positivity was still
evident only in the second layer of haploid germ cells immediately surrounding the lumen (elongating spermatids at step 13
of spermiogenesis), and it was absent from stages II to VII
(round spermatids at steps 1-7, and elongating spermatids at
steps 14-16). No β-galactosidase activity was detected in seminiferous tubules of non-transgenic animals. β-galactosidase
staining observed in interstitial cells, both in control and in
transgenic animals, is due to endogenous activity, as already
observed by others (Behringer et al., 1993). No expression was
found in other organs of transgenic animals (such as brain, liver,
kidney, skeletal muscle and heart). The copy number of the integrated transgene did not appear to affect the degree of its
expression in spermatids, since one of the families (‘orange’)
had multiple copies integrated into the genome, whereas the
second one (‘blue’) had only two copies, but expression of lacZ
in haploid cells appeared to be of the same intensity. Intensity
of lacZ expression appeared to be similar in mice homozygous
for the transgene and in heterozygous mice. The two other
expressing lines of transgenic animals (‘violet’ and ‘green’)
showed a weaker histochemical detection of β-galactosidase
activity, again exclusively in seminiferous tubules, whereas
members of the fifth family (‘red’) were negative, in perfect
agreement with the results of expression at the RNA level.
Thus, the 16th intron of the mouse c-kit gene contains sufficient information for tissue- and developmental stage-specific
transcription of the reporter gene in haploid germ cells, and it
is active only in the latest transcriptional steps of round spermatids (steps 8-9). These data suggest that production of the
truncated form of the c-kit receptor should start during the steps
of elongation of haploid cells (from step 9 of spermiogenesis),
when tail and acrosome formation, and nuclear elongation and
condensation occur.
The truncated form of c-kit accumulates in
elongating spermatids
A polyclonal antibody, raised against the last 13 amino acids
of the cytoplasmic carboxyterminal part of the mouse c-kit
receptor, detects a clear membrane staining in mitotic germ
cells cocultured with Sertoli cells in tissue explants, whereas
no staining is detectable in the underlying somatic monolayer
(Fig. 11). Membrane staining in mitotic germ cells is due to
the specific expression in type A spermatogonia of the normal
approx. 140-160×103 Mr receptor, confirmed by western blot
analysis (data not shown). Antibodies against the extracellular
domain of the c-kit receptor stain only spermatogonia and early
spermatocytes, but not spermatids (Yoshinaga et al., 1991). To
establish whether a truncated c-kit protein of the size predicted
on the basis of molecular cloning of the alternative c-kit transcripts is actually present during the haploid phase of spermatogenesis, we performed western blot experiments using our
polyclonal antibody, raised against the cytoplasmic carboxyterminal part of the mouse c-kit receptor (Fig. 12). A
protein of approx. 23×103 Mr (A), corresponding to the size
predicted by the ORF (606 bp = 202 aa) of the alternative ckit cDNA (Rossi et al., 1992), can be identified in haploid cells,
but not in meiotic spermatocytes (P.Sc.), only with the immune
serum. The intensity of the band progressively increases during
spermiogenesis (from steps 1-8 to steps 9-12), reaching a
maximum in the final steps of spermatid elongation (steps 1316). The same approx. 23×103 Mr protein is also present in
mature spermatozoa obtained from the epididymis (S.zoa).
Transfection of COS cells with a eukaryotic expression
vector containing the ORF of the spermatid-specific c-kit transcript resulted in expression of an immunoreactive protein of
similar size (Fig. 13, left panel). The other aspecific bands,
present in both transfected and control COS cells, were also
detected by the preimmune serum (not shown). A protein of
similar size was specifically detected by the immune serum
after expression of the spermatid-specific c-kit ORF in E. coli,
using a prokaryotic expression vector (Fig. 13, right panel).
An additional band of approx. 48×103 Mr is also specifically
recognized by the immune serum in haploid germ cells and
spermatozoa (B in Fig. 12), but not in COS cells or in E. coli
(Fig. 13). Detection of both the A and B bands in elongating
spermatids is suppressed after preincubation of the immune
serum with an excess of the peptide that had been utilized to
immunize rabbits (lane labelled C in Fig. 12), whereas
aspecific bands are still present, thus confirming that the A and
B signals should correspond to specific c-kit gene products. We
1298 C. Albanesi and others
Fig. 9. Sequences within the 16th intron of the mouse c-kit gene drive
specific expression of the E. coli lacZ reporter gene in male haploid
germ cells in vivo. Top: two transilluminated whole seminiferous
tubules isolated from the testis of an adult F4 heterozygous
transgenic mouse (‘orange’ line), after staining of the whole fixed
organ with X-gal. Expression of β-galactosidase is revealed by a
green precipitate in the central part of the tubules, which is clearly
evident in some areas, but reduced or absent in others. Bottom: two
photographs of 30 µm frozen sections of testis from another
transgenic animal. The blue-green precipitate, due to β-galactosidase,
is evident in haploid germ cells immediately surrounding the lumen
of some, but not all, sections of seminiferous tubules. The scale bar
equals 75 µm for the two top pictures, 50 µm for the left bottom
picture, and 25 µm for the right bottom picture.
do not know the nature of the approx. 48×103 Mr B signal in
haploid cells, but a reasonable interpretation is that it reflects
a covalent interaction of the approx. 23×103 Mr c-kit protein
with other proteins present only in haploid cells, due to
formation of disulfide bonds between cysteine residues. Indeed
its intensity varies according to the sample preparation, it is
greatly reduced by increasing threefold the concentration of 2mercaptoethanol in the samples before SDS-gel electrophoresis, whereas a corresponding increase in the level of the
Stage I
IX
III
X
V
XI
VII
XII
Fig. 10. Stage-specific expression of the ckit-lacZ reporter gene during
spermiogenesis in transgenic mice. 5 µm
sections of paraffin-embedded testis of an
adult F4 heterozygous transgenic mouse
(‘orange’ line), after staining of the whole
fixed organ with X-gal. Sections were
stained with PAS and counterstained with
hematoxylin. The different pictures
represent segments of seminiferous tubules
representative of 8 of the 12 stages of the
mouse seminiferous epithelium. In each
picture, the bottom part represents the
periphery of seminiferous tubules, whereas
the top part corresponds to the central
lumen, with the exception of stage X, in
which the lumen is in the middle of the
picture (this section being longitudinal
instead of a cross-section). Expression of
β-galactosidase is revealed by a blue-green
precipitate, which is clearly evident in
haploid germ cells in stages IX-XI, reduced
in stages XII-I, and absent from stages II to
VII. Specific testicular cell types: S.C.,
Sertoli cell; Sg, spermatogonium; Sc I,
primary spermatocyte; Sc II, secondary
spermatocytes at metaphase; Sd1-Sd16,
spermatids from steps 1 to 16 of
spermiogenesis. The scale bar equals
6.5 µm.
Intronic c-kit promoter active in spermatids 1299
same antibody showed that specific immunostaining can be
observed in the elongating steps of spermiogenesis. With
respect to the background fluorescence observed with antibodies from the preimmune serum, fluorescence with the
antibody from the immune serum is constantly very strong in
the region of the head, and can be observed occasionally in
the middle piece of the spermatid tail (Fig. 14). Strong positivity is also constantly observed in residual bodies, which
might account for the reduction in the intensity of c-kit
immunoreactive bands observed in western blot analysis of
epididymal spermatozoa with respect to elongating spermatids
at steps 13-16 (see Fig. 12).
DISCUSSION
Fig. 11. The transmembrane c-kit receptor present in spermatogonia
from young mice is recognized by antibodies directed against the last
13 amino acids of the mouse c-kit ORF. Immunofluorescence
staining with a polyclonal antibody, raised against the cytoplasmic
carboxy-terminal domain of mouse c-kit protein, or preimmune
serum, of seminiferous tubule explants from 13-day old mice after 4
days of culture. Positive cells are spermatogonia lying on negative
Sertoli cell monolayers. The scale bar equals 10 µm.
approx. 23×103 Mr band is observed in this condition (see the
lane labeled with an asterisk in Fig. 12) and, finally, the progressive accumulation of this band during spermiogenesis
parallels exactly that of the approx. 23×103 Mr band.
Preliminary immunofluorescence experiments with the
The cryptic promoter present within the c-kit gene may be
viewed as a further example of haploid-specific transcription;,however it appears to be not only tissue- and cell-specific,
but also stage-specific. Indeed, transgenic experiments indicate
that β-galactosidase activity starts to be evident in spermatids
at steps 8-9, suggesting that a cryptic haploid-specific promoter
present within the 16th intron of the c-kit gene is selectively
active at the end of the transcriptional phase of spermiogenesis.
Other promoters active in adult male germ cells identified
up to now, such as those for protamine-1 (Peschon et al., 1987),
protamine 2 (Stewart et al., 1988), PGK2 (Robinson et al.,
1989), ACE (Langford et al., 1991), proenkephalin (Zinn et al.,
1991), proacrosin (Nayernia et al., 1992), Hoxa-4 (Behringer
et al., 1993), Tcp-10bt (Ewulonu et al., 1993), hst70 (Wisniewski et al., 1993), p53 (Almon et al., 1993), β-actin (Sands
et al., 1993), Zfy-1 (Zambrowicz et al., 1994) and calmodulin
II (Ikeshima et al., 1994), have been shown to be active in
earlier stages of spermatogenesis (meiosis and/or early
spermiogenesis) with respect to what we observe with the
cryptic intronic c-kit promoter.
Deletion analysis in both DNA-binding and in vitro transcription experiments suggests that at least two cis-acting
elements are essential for stage-specific activation of this
promoter during spermiogenesis: the ‘enhancer core’ element
between −464 and −456, and the region between −68 and −50,
which contains sequences similar to those essential for
promoter regulation of interferon and interferon-regulated
Fig. 12. The truncated form of the c-kit protein
translated from the alternative c-kit mRNAs
transcribed in round spermatids is accumulated in
elongating spermatids, and is also present in
epididymal spermatozoa. The first nine lanes
show western blot analyses of cell extracts from
meiotic (P.Sc., pachytene spermatocytes) and
postmeiotic germ cells at the indicated phase of
maturation using a polyclonal antibody against the
cytoplasmic carboxyterminal domain of mouse ckit protein or preimmune serum. The lane
indicated by an asterisk represents the sample of
spermatids at steps 13-16 after a threefold
increase in the amount of 2-mercaptoethanol before loading (from 50 mM to 150 mM). The last three lanes show a different experiment, in
which cell extracts from epididymal spermatozoa (S.zoa), and from a different preparation of elongating spermatids at steps 9-12, were
analyzed with the immune serum. The last lane (C), was treated with the antibody that had been preincubated for specific competition with
approx. 100-fold molar excess of the oligopeptide utilized to immunize rabbits. A and B on the right side of the picture indicate the position of
the bands specifically recognized by the immune serum.
1300 C. Albanesi and others
Fig. 13. A protein of the same size predicted by the ORF of the
spermatid-specific c-kit cDNA can be produced in artificial
eukaryotic or prokaryotic expression systems. Left panel: western
blot analysis of transfected eukaryotic cells using the polyclonal
antibody against the cytoplasmic carboxy-terminal domain of mouse
c-kit protein. Expression of the truncated c-kit receptor
approximating the predicted size of approx. 23×103 Mr is evident in
COS cells transfected with an eukaryotic expression vector
containing the spermatid-specific c-kit ORF, but not in mocktransfected COS cells. Right panel: western blot analysis of
transformed prokaryotic cells using the polyclonal antibody against
the cytoplasmic carboxy-terminal domain of mouse c-kit protein.
Expression of the truncated c-kit receptor of the predicted size
(approx. 23×103 Mr) is evident in E. coli cells transformed with a
prokaryotic expression vector containing the spermatid-specific c-kit
ORF, but not in wild-type E. coli cells, nor in transformed bacteria
without IPTG induction.
Fig. 14. Elongating spermatids and residual bodies are strongly
positive to anti-c-kit antibodies in immunofluorescence experiments.
Immunofluorescence staining of postmeiotic germ cells in advanced
phases of maturation, with a polyclonal antibody against the
cytoplasmic carboxy-terminal domain of mouse c-kit protein or
preimmune serum. Spermatids at steps 13-16 and residual bodies had
been obtained from adult mouse testes through elutriation
techniques. The scale bar equals 10 µm.
genes. This observation raises the possibility that related
cytokines, which might be locally produced in the microenvironment of the seminiferous epithelium, could influence the
expression of this or similar stage-specific promoters during
spermiogenesis.
In agreement with the stages of activation of the cryptic ckit promoter in transgenic mice, immunoblotting and immunofluorescence experiments show that a truncated c-kit protein
starts to accumulate at the same maturative steps, reaching a
maximum in the elongating phase of spermiogenesis, and that
the protein is also present in epididymal spermatozoa.
None of the mutations in the W locus identified up to now
can lead us to propose a role for the truncated c-kit protein
expressed in late spermiogenesis. Deletion of the transmembrane domain of the c-kit receptor in the classical W mutation
(Nocka et al., 1991) is accompanied by complete absence of
germ cells within the postnatal testis, due to lack of migration
and/or proliferation of primordial germ cells in the embryonal
gonad (Coulombre and Russell, 1954). A point mutation in the
ATP-binding site of the intracellular domain of c-kit in Wv
mutants (Nocka et al., 1991) is accompanied by presence of
spermatogonia and few meiotic germ cells after birth, but spermatogenesis is completely arrested after these phases
(Coulombre and Russell, 1954), raising the hypothesis of a
possible function for the c-kit gene not only in germ cells in the
early stages of development, but also in early meiotic stages of
spermatogenesis. Mutations in the phosphotransferase domain
of the c-kit protein (corresponding to the truncated c-kit protein
expressed in postmeiotic germ cells), probably due to a different
degree of impairment of tyrosine-kinase function (Nocka et al.,
1991), are associated to either a severe phenotype, such as in
W42, which is deleterious for gameto-genesis also in the heterozygous condition (Tan et al., 1990), or to mild effects on
male fertility, such as in W41. It cannot be excluded that other,
still unknown, mutations in the carboxyterminal domain of the
c-kit receptor selectively impair spermiogenesis or sperm cell
function, without affecting mitotic germ cells or stem cells of
other lineages. Such mutants, not presenting pigmentation
defects, would not be easy to identify phenotypically. Since the
truncated c-kit protein should lack intrinsic kinase activity, its
expression after the beginning of spermatid elongation could
imply a tyrosine-kinase-independent role for the c-kit carboxy
terminus during sperm cell morphogenesis, as has been
proposed for the carboxyterminal domain of Drosophila c-abl
protooncogene in axonal outgrowth during neurogenesis
(Henkemeyer et al., 1990).
Rather than in sperm cell morphogenesis, the truncated c-kit
protein might play a role in mature sperm cell function, during
or after fertilization. Indeed, assuming that it has not an intraacrosomal location, it might be transferred by the spermatozoon into the oocyte. In this case, a functional interaction
between the truncated c-kit protein eventually transferred by
the fertilizing sperm cell and the full-length c-kit receptor
expressed in mature oocytes (Manova et al., 1990; Horie et al.,
1991; Yoshinaga et al., 1991) might be possible locally, at the
point of membrane fusion. The functional significance of the
presence of the full length c-kit receptor in mature oocytes and
early embryogenesis is unknown, since the c-kit ligand
expression in follicle cells surrounding growing oocytes
(Motro et al., 1991) ceases at the end of maturation of the
female gamete (Manova et al., 1993). A functional interaction
Intronic c-kit promoter active in spermatids 1301
between a full-length tyrosine kinase receptor and a truncated
receptor containing only the intracellular kinase domain, with
consequent receptor activation, independent of ligand binding,
has been recently demonstrated in cotransfection experiments
in the case of the EGF receptor (Chantry, 1995).
In the very recent literature, some answers to the functional
meaning of haploid specific transcription from alternative
promoters of genes normally expressed in diploid cells are
coming from gene knock-out experiments, such as the case of
ACE (Krege et al., 1995), which has been shown to have an
unexpected, important role in male fertility. Promoter
sequences within the 16th intron of the mouse c-kit gene could
be an ideal target for homologous recombination in order to
establish the functional meaning of the truncated receptor in
spermatids, without altering the structure of the normal
receptor expressed in the mitotic phase of spermatogenesis and
in stem cells of the hematopoietic and melanoblastic lineages.
This work was supported by CNR targeted project ‘FATMA’ n.
94.00590.PF41, Telethon-Italy grant n. D.2, grants from AIRC, and
by the WHO special program for Research Development and
Research Training in Human Reproduction. M.G. was the recipient
of an AIRC fellowship. We are indebted to Prof. Vincenzo Sorrentino
and Dr Giovanna Marziali for the generous gift of plasmid p-kit-int,
and for the preparation of polyclonal antibodies utilized in this work
at the EMBL facilities (Heidelberg, Germany). We especially thank
Dr Laura Pozzi for her collaboration in the generation of transgenic
mice. We also thank Drs Domenica Piscitelli, Maria Laura Giustizieri
and Ms Naomi De Luca for their help in the initial stages of this work.
REFERENCES
Almon, E., Goldfinger, N., Kapon, A., Schwartz, D., Levine, A. J. and
Rotter, V. (1993). Testicular tissue-specific expression of the p53 suppressor
gene. Dev. Biol. 156, 107-116.
Behringer, R. R., Crotty, D. A., Tennyson, V. M., Brinster, R. L., Palmiter,
R. D. and Wolgemuth, D. J. (1993). Sequences 5′ of the homeobox of the
Hox-1.4 gene direct tissue-specific expression of lacZ during mouse
development. Development 117, 823-833.
Besmer, P. (1991). The kit ligand encoded at the murine steel locus: a
pleiotropic growth and differentiation factor. Curr. Opin. Cell. Biol. 3, 939946.
Brinster, R. L., Chen, H. Y., Trumbauer, M., Yagle, M. K. and Palmiter, R.
D. (1985). Factors affecting the efficiency of introducing foreign DNA into
mice by microinjecting eggs. Proc. Natl. Acad. Sci. USA 82, 4438-4442.
Brinster, R. L. and Avarbock, M. R. (1994). Germline transmission of donor
haplotype following spermatogonial transplantation. Proc. Natl. Acad. Sci.
USA 91, 11303-11307.
Bunick, D., Johnson, P. A., Johnson, P. R. and Hecht, N. B. (1990).
Transcription of the testis-specific mouse protamine 2 gene in homologous in
vitro transcription system. Proc. Natl. Acad. Sci. USA 87, 891-895.
Chabot, B., Stephenson, D. A., Chapman, V. M., Besmer,
P . a n d B e r n s t e i n , A . ( 1 9 8 8 ) . T h e protooncogene c-kit encoding a
transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature
335, 88-89.
Chantry, A. (1995). The kinase domain and membrane localization determine
intracellular interactions between epidermal growth factor receptors. J. Biol.
Chem. 270, 3068-3073.
Coulombre, J. L. and Russell, E. S. (1954). Analysis of the pleiotropism at the
W-locus in the mouse. J. Exp. Zool. 126, 277-295.
Dolci, S., Williams, D. E., Ernst, M. K., Resnick, J. L., Brannan, C. I., Lock,
L. F., Lyman, S. D., Boswell, H. S. and Donovan, P. J. (1991).
Requirement for mast cell growth factor for primordial germ cell survival in
culture. Nature 352, 809-811.
Ewulonu, U. K., Buratynski, T. J. and Schimenti, J. C. (1993). Functional
and molecular characterization of the transcriptional regulatory region of
Tcp-10bt, a testes-expressed gene from the T complex responder locus.
Development 117, 89-95.
Faisst, S. and Meyer, S. (1992). Compilation of vertebrate-encoded
transcription factors. Nucleic Acids Res. 20, 3-26.
Flanagan, J. F., Chan, D. C. and Leder, P. (1991). Transmembrane form of
the kit ligand growth factor is determined by alternative splicing and is
missing in the Sld mutant. Cell 64, 1025-1035.
Godin, I., Deed, R., Cooke, J., Zsebo, K., Dexter, M. and Wylie, C. C.
(1991). Effects of the steel gene product on mouse primordial germ cells in
culture. Nature 352, 807-809.
Gokkel, E., Grossman, Z., Ramot, B., Yarden, Y., Rechavi, G. and Givol,
D. (1992). Structural organization of the murine c-kit proto-oncogene.
Oncogene 7, 1423-1429.
Gorman, C. M., Moffat, L. F. and Howard, B. H. (1982). Recombinant
genomes which express chloramphenicol acetyl transferase in mammalian
cells. Mol. Cell. Biol. 2, 1044-1051.
Grimaldi, P., Piscitelli, D., Albanesi, C., Blasi, F., Geremia, R. and Rossi, P.
(1993). Identification of 3′,5′-cyclic adenosine monophosphate-inducible
nuclear factors binding to the human urokinase promoter in mouse Sertoli
cells. Mol. Endocrinol. 7, 1217-1225.
Hecht, N. B. (1990). Regulation of ‘haploid’ expressed genes in male germ
cells. J. Reprod. Fertil. 88, 679-693.
Henkemeyer, M., West, S. R., Gertler, F. B. and Hoffmann, F. M. (1990). A
novel tyrosine-kinase-independent function of Drosophila abl correlates
with proper subcellular localization. Cell 63, 949-960.
Horie, K., Takakura, K., Taii, S., Narimoto, K., Noda, Y., Nishikawa, S.,
Nakayama, H., Fujita, J. and Mori, T. (1991). The expression of the c-kit
protein during oogenesis and early embryonic development. Biol. Reprod.
45, 547-552.
Ikeshima, H., Shimoda, K., Matsuo, K., Hata, J., Maejima, K. and Takano,
T. (1994). Spermatocyte-specific transcription by calmodulin gene II
promoter in transgenic mice. Mol. Cell. Endocrinol. 99, 49-53.
Keller, A. D. and Maniatis, T. (1991). Identification and characterization of a
novel repressor of β-interferon gene expression. Genes Dev. 5, 868-879.
Krege, J. H., John, S. W. M., Langenbach, L. L., Hodgin, J. B., Hagaman,
J. R., Bachman, E. S., Jennette, J. C., O’Brien, D. A. and Smithies, O.
(1995). Male-female differences in fertility and blood pressure in ACEdeficient mice. Nature 375, 146-148.
Langford, K. G., Shai, S. -Y., Howard, T. E., Kovac, M. J., Overbeek, P. A.
and Bernstein, K. E. (1991). Transgenic mice demonstrate a testis-specific
promoter for angiotensin-converting enzyme. J. Biol. Chem. 266, 1555915562.
Manova, K., Nocka, K., Besmer, P. and Bachvarova, R. F. (1990). Gonadal
expression of c-kit encoded at the W locus of the mouse. Development 110,
1057-1069.
Manova, K. and Bachvarova, R. F. (1991). Expression of c-kit encoded at the
W locus of mice in developing embryonic germ cells and presumptive
melanoblasts. Dev. Biol. 146, 312-324.
Manova, K., Huang, E. J., Angeles, M., De Leon, V., Sanchez, S., Pronovost,
S. M., Besmer, P. and Bachvarova, R. F. (1993). The expression pattern of
the c-kit ligand in gonads of mice supports a role for the c-kit receptor in
oocyte growth and in proliferation of spermatogonia. Dev. Biol. 157, 85-99.
McCarrey, J. R. and Thomas, K. (1987). Human testis-specific PGK gene
lacks introns and possesses characteristics of a processed gene. Nature 326,
501-505.
Meistrich, M. L. (1977). Separation of spermatogenic cells and nuclei from
rodent testes. Meth. Cell Biol. 15, 15-54.
Motro, B., van der Kooy, D., Rossant, J., Reith, A. and Bernstein, A. (1991).
Contiguous patterns of c-kit and steel expression: analysis of mutations at the
W and Sl loci. Development 113, 1207-1221.
Nayernia, K., Burkhardt, E., Beimesche, S., Keime, S. and Engel, W.
(1992). Germ-cell-specific expression of a proacrosine-CAT fusion gene in
transgenic mouse testis. Mol. Reprod. Dev. 31, 241-248.
Nocka, K., Tan, J. C., Chiu, E., Chu, T. Y., Ray, P., Traktman, P. and
Besmer, P. (1990). Molecular bases of dominant negative and loss of
function mutations at the murine c-kit/white spotting locus: W37, Wv, W41 and
W. EMBO J. 9, 1805-1813.
Peschon, J. J., Behringer, R. R., Brinster, R. L. and Palmiter, R. (1987).
Spermatid-specific expression of protamine 1 in transgenic mice. Proc. Natl.
Acad. Sci. USA 84, 5316-5319.
Propst, F., Rosenberg, M. P. and Vande Woude, G. F. (1988). Protooncogene expression in germ cell development. Trends Genet. 4, 183-187.
Qiu, F., Ray, P., Barker, P. E., Jhanwar, S., Ruddle, F. H. and Besmer, P.
(1988). Primary structure of c-kit: relationship with the CSF-1/PDGF
receptor kinase family - oncogenic activation of v-kit involves deletion of
extracellular domain and C terminus. EMBO J. 7, 1003-1011.
1302 C. Albanesi and others
Robinson, M. O., McCarrey, J. R. and Simon, M. I. (1989). Transcriptional
regulatory regions of testis-specific PGK2 defined in transgenic mice. Proc.
Natl. Acad. Sci. USA 86, 8437-8441.
Rossi, P., Albanesi, C., Grimaldi, P. and Geremia, R. (1991). Expression of
the mRNA for the ligand of c-kit in mouse Sertoli cells. Biochem. Biophys.
Res. Commun. 176, 910-914.
Rossi, P., Marziali, G., Albanesi, C., Charlesworth, A., Geremia, R. and
Sorrentino, V. (1992). A novel c-kit transcript, potentially encoding a
truncated receptor, originates within a kit gene intron in mouse spermatids.
Dev. Biol. 152, 203-207.
Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P. and Geremia, R. (1993a).
Direct evidence that the mouse sex-determining gene Sry is expressed in the
somatic cells of male fetal gonads and in the germ cell line in the adult testis.
Mol. Reprod. Dev. 34, 369-373.
Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P., Ricca, R. and Geremia, R.
(1993b). Follicle-stimulating hormone induction of steel Factor (SLF)
mRNA in mouse Sertoli cells and stimulation of DNA synthesis in
spermatogonia by soluble SLF. Dev. Biol. 155, 68-74.
Russell, E. S. (1979). Hereditary anemias of the mouse: a review for
geneticists. Adv. Genet 20, 357-459.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). In Molecular Cloning;
A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory press.
Sands, A. T., Hansen, T. N., Demayo, F. J., Stanley, L. A., Xin, L. and
Schwartz, R. J. (1993). Cytoplasmic beta-actin promoter produces germ cell
and preimplantation embryonic transgene expression. Mol. Reprod. Dev. 34,
117-126.
Sorrentino, V., McKinney, M. D., Giorgi, M., Geremia, R. and Fleissner, E.
(1988). Expression of cellular protooncogenes in the mouse male germ line:
a distinctive 2.4 kilobase pim-1 transcript is expressed in haploid postmeiotic
cells. Proc. Natl. Acad. Sci. USA 85, 2191-2195.
Sorrentino, V., Giorgi, M., Geremia, R., Besmer, P. and Rossi, P. (1991).
Expression of the c-kit proto-oncogene in the murine male germ cells.
Oncogene 6, 149-151.
Stewart, T. A., Hecht, N. B., Hollingshead, P. G., Johnson, P. A., Leong, J.
A. and Pitts, S. L. (1988). Haploid-specific transcription of protamine-myc
and protamine-T-antigen fusion genes in transgenic mice. Mol. Cell. Biol 8,
1748-1755.
Tan, J. C., Nocka, K., Ray, P., Traktman, P. and Besmer, P. (1990). The
dominant W42 spotting phenotype results from a missense mutation in the ckit receptor kinase. Science 247, 209-212.
Tanaka, N., Kawakami, T. and Taniguchi, T. (1993). Recognition DNA
sequences of interferon regulatory factor 1 (IRF-1) and IRF-2, regulators of
cell growth and the interferon system. Mol. Cell. Biol. 13, 4531-4538.
Wisniewski, J., Malezewski, M., Krawczyc, Z. and Gedamu, L. (1993). An
upstream region of the rat spermatogenesis-specific heat-shock-like hst70
gene confers testis-specific expression in transgenic mice. Eur. J. Biochem
212, 137-143.
Yoshinaga, K., Nishikawa, S., Ogawa, M., Hayashi, S., Kunisada, T.,
Fujimoto, T. and Nishikawa, S. -I. (1991). Role of c-kit in mouse
spermatogenesis: identification of spermatogonia as a specific site of c-kit
expression and function. Development 113, 689-699.
Zambrowicz, B. P., Zimmermann, J. W., Harendza, C. J., Simpson, E. M.,
Page, D. C., Brinster, R. L. and Palmiter, R. D. (1994). Expression of a
mouse Zfy-1/lacZ transgene in the somatic cells of the embryonic gonad and
germ cells of the adult testis. Development 120, 1549-1559.
Zinn, S. A., Ebert, K. M., Mehta, N. D., Joshi, J. and Kilpatrick, D. L.
(1991). Selective transcription of rat proenkephalin fusion genes from the
spermatogenic cell-specific promoter in testis of transgenic mice. J. Biol.
Chem. 266, 23850-23855.
(Accepted 27 December 1995)