Journal of General Virology (2008), 89, 130–137
DOI 10.1099/vir.0.83287-0
Molecular characterization of the first polyomavirus
from a New World primate: squirrel monkey
polyomavirus
Ernst J. Verschoor,1 Marlous J. Groenewoud,1 Zahra Fagrouch,1
Aruna Kewalapat,1 Sabine van Gessel,1 Marja J. L. Kik2
and Jonathan L. Heeney13
Correspondence
Ernst J. Verschoor
[email protected]
Received 4 July 2007
Accepted 17 September 2007
1
Department of Virology, Biomedical Primate Research Centre, Rijswijk, The Netherlands
2
Department of Pathobiology, Pathology, Faculty of Veterinary Medicine, Utrecht University,
Utrecht, The Netherlands
DNA samples from a variety of New World monkeys were screened by using a broad-spectrum
PCR targeting the VP1 gene of polyomaviruses. This resulted in the characterization of the
first polyomavirus from a New World primate. This virus naturally infects squirrel monkeys (Saimiri
sp.) and is provisionally named squirrel monkey polyomavirus (SquiPyV). The complete genome of
SquiPyV is 5075 bp in length, and encodes the small T and large T antigens and the three
structural proteins VP1, VP2 and VP3. Interestingly, the late region also encodes a putative
agnoprotein, a feature that it shares with other polyomaviruses from humans, baboons and African
green monkeys. Comparison with other polyomaviruses revealed limited sequence similarity to any
other polyomavirus, and phylogenetic analysis of the VP1 gene confirmed its uniqueness.
INTRODUCTION
Polyomaviruses (PyVs) are non-enveloped viruses with a
circular, double-stranded DNA genome of about 5 kb. The
genome consists of an early and a late coding region, and
transcription is bidirectional from the origin of replication
(ori), which lies within the non-coding, regulatory region.
The early region encodes the viral regulatory proteins, the
small and large tumour (T) antigens. The late region of all
PyVs encodes the viral structural proteins, VP1, VP2 and
VP3, but in some PyVs, the late region also accommodates
the gene for an agnoprotein, which is located upstream of
the VP2 gene.
PyVs cause infections in birds and mammals. Primate PyVs
have been characterized from humans (JC, BK, KI and WU
viruses) (Allander et al., 2007; Gardner et al., 1971; Gaynor
et al., 2007; Padgett et al., 1971), chimpanzees (chimpanzee
polyomavirus, ChPyV) (Johne et al., 2005), macaques
(simian virus 40, SV40), baboons (simian virus 12, SA12),
and African green monkeys (African green monkey
3Present address: Department of Veterinary Medicine, University of
Cambridge, Cambridge, UK.
The GenBank/EMBL/DDBJ accession numbers for the SquiPyV
complete genome sequence and partial large T sequences are
AM748741 and AM779570–AM779573, respectively.
An alignment of large T gene PCR fragments of SquiPyV and a table
showing SquiPyV-specific primers used in this study are available with
the online version of this paper.
130
polyomavirus; lymphotropic polyomavirus) (Sweet &
Hilleman, 1960; Takemoto et al., 1982; Takemoto &
Segawa, 1983; Valis et al., 1977; zur Hausen & Gissmann,
1979). Other mammalian PyVs have been characterized
from cattle (bovine polyomavirus, BoPyV) (Schuurman
et al., 1990) and rodents such as hamsters and mice
[hamster and murine polyomaviruses; murine pneumotropic virus (MPtV)] (Graffi et al., 1968; Gross, 1953).
In humans, JC virus (JCV) and BK virus (BKV) exist as
persistent infections, with high prevalences in the human
population worldwide of about 80 and 90 %, respectively.
Infection with JCV and BKV is asymptomatic in healthy
individuals, but reactivation can occur in immunocompromised individuals, such as AIDS patients and transplant
recipients, causing serious pathogenic sequelae. JCV can
cause the lethal brain disease progressive multifocal
leukoencephalopathy (PML), and reactivation of BKV
can cause irreversible damage to the kidneys due to
polyomavirus-associated nephropathy (PVAN). Recently,
two additional human viruses, KI and WU viruses, have
been characterized from patients with respiratory-tract
infections, although their role as causative agent has not yet
been confirmed (Allander et al., 2007; Gaynor et al., 2007).
The macaque PyV SV40 has transforming properties in cell
culture, and also induces tumours in newborn hamsters
(Eddy et al., 1962; Girardi et al., 1962). The discovery that
SV40 had been a contaminant of poliovirus vaccines
produced on monkey cells, and that millions of people had
Downloaded from www.microbiologyresearch.org by
0008-3287 G 2008 SGM
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
Printed in Great Britain
Characterization of squirrel monkey polyomavirus
been exposed accidentally to SV40 by this route, initiated
much interest in the potential correlation between SV40
infection and the occurrence of human cancers (reviewed
by Butel et al., 2003; Dang-Tan et al., 2004; Elmishad et al.,
2006; Poulin & DeCaprio, 2006; White et al., 2005). The
zoonotic potential of SV40 is emphasized by the finding of
antibodies to this virus in the blood of humans working
with primates (Engels et al., 2004; Shah, 1966).
Because of the potential threats of zoonotic transfer of
PyVs to humans, knowledge of PyVs infecting non-human
primates is important, especially those viruses found in
primate species commonly used in biomedical research.
PyVs have been characterized from several species, such as
macaques and baboons, but until now, no such virus has
been characterized from New World monkey species used
in research, such as marmosets (Callithrix sp.), tamarins
(Saguinus sp.), owl monkeys (Aotus sp.) and squirrel
monkeys (Saimiri sp.). In this paper, we present the
complete nucleotide sequence of a PyV infecting Bolivian
squirrel monkeys (Saimiri boliviensis), squirrel monkey
polyomavirus (SquiPyV), and demonstrate that SquiPyV is
a virus that is indigenous to squirrel monkeys. Genome
analysis shows a prototypical PyV genomic structure, and
phylogenetic analysis of the structural gene VP1 shows that
SquiPyV is related most closely to BoPyV.
METHODS
Cloning and sequence analysis. PCR products were isolated from
agarose gel by using a Zymoclean Gel DNA recovery kit (Zymo
Research) and thereafter cloned in the pGEM-T Easy vector
(Promega). PCR fragments were sequenced either directly or after
TA cloning with an ABI PRISM BigDye Terminator v3.0 Cycle
Sequencing kit on an ABI PRISM 3100 Genetic Analyzer (PE Applied
Biosystems). Each fragment was sequenced with at least threefold
coverage to avoid sequencing errors. Sequences were analysed by
using MacVector 8.1.1 (Accelrys) and SeqMan II (DNASTAR) sequenceanalysis software packages.
Phylogenetic analysis. Sequence alignments were made by using
MacVector 8.1.1. and Se-Al v. 2.0a11 (Rambaut, 1996). The program
GapStreeze was used to remove columns that contained gaps from the
alignment (Los Alamos HIV Sequence Database; http://www.hiv.
lanl.gov/content/hiv-db/GAPSTREEZE/gap.html). Phylogenetic analysis was performed by using PAUP version 4.0b10 (Swofford, 2002).
RESULTS
Tissue samples and DNA isolation. Spleen samples were obtained
from animals that were sent for pathological examination to the
Department of Pathobiology of the Veterinary Faculty, University of
Utrecht. Archival frozen blood samples from S. boliviensis were also
used in this study. DNA was isolated from the spleen and blood
samples by using a Puregene Blood kit (Gentra Systems).
Diagnostic VP1 PCR. DNA samples were screened by using
degenerate primers for VP1 as described by Johne et al. (2005). A
nested PCR was performed in a volume of 50 ml, using 1 mg DNA,
10 mM Tris/HCl (pH 8.3), 50 mM KCl, 0.01 % BSA, 1 mM each
primer, 2.5 mM MgCl2, 200 mM each dNTP and 1.25 U AmpliTaq
Gold (PE Applied Biosystems). The first amplification reaction was
performed with an enzyme-activation step of 15 min at 95 uC, followed
by 45 amplification cycles of 94 uC for 20 s, 46 uC for 20 s and 72 uC
for 60 s. In the second amplification reaction, 2 ml PCR product of the
outer PCR was used as template. This second amplification reaction
consisted of enzyme activation for 15 min at 95 uC, followed by 45
cycles of 15 s at 94 uC, 15 s at 56 uC and 20 s at 72 uC.
Amplification of the SquiPyV genome. The sequence of the
SquiPyV VP1 PCR fragment was used to design primers for a nested
long PCR that targets the remaining part of the circular DNA genome
(see Supplementary Table S1, available in JGV Online). The long PCR
was performed with the Expand High Fidelity PCR system (Roche
Diagnostics) in a volume of 50 ml, using 1.0 mg DNA, 1 mM each
primer, 2.0 mM MgCl2, 200 mM each dNTP and 0.75 ml Expand High
Fidelity enzyme mix (3.5 U ml21). Both amplification reactions
consisted of an initial denaturation step of 2 min at 95 uC, followed
by 10 cycles of 15 s at 94 uC, 30 s at 55 uC and 4 min at 68 uC, then
followed by 21 cycles of 15 s at 94 uC, 30 s at 55 uC and 4 min at
68 uC, in which 5 s per cycle was added to the extension phase. The
reaction was finalized with 7 min incubation at 72 uC.
http://vir.sgmjournals.org
SquiPyV-specific diagnostic PCR. A nested set of primers was
designed for a PCR assay that targets the large T antigen of SquiPyV
specifically (Supplementary Table S1). The outer amplification
reaction was performed in a volume of 50 ml, using 1 mg DNA,
10 mM Tris/HCl (pH 8.3), 50 mM KCl, 0.01 % BSA, 1 mM each
primer, 3.0 mM MgCl2, 200 mM each dNTP and 1.25 U AmpliTaq
Gold. The reaction mixture for the inner reaction was identical to the
outer reaction mixture but, as a template, 2 ml PCR product of the
first reaction was used, with 3.0 mM MgCl2. Samples were pre-heated
for 15 min at 95 uC to activate the enzyme, and then cycled for 20 s at
95 uC, 20 s at 55 uC and 50 s at 72 uC for 45 rounds of amplification.
Detection of PyVs in New World monkeys
DNA was extracted from spleen tissue or frozen blood of
various New World monkey species. A selection of samples
was made on the basis of the New World monkey
phylogeny (Schneider, 2000) and care was taken that
representatives of all recognized New World monkey
families (Atelidae, Pitheciidae and Cebidae) and most
subfamilies were included in our selection (Table 1). All
tissues were collected during routine pathological examination of zoo animals that had died due to different
clinical causes. However, none exhibited disease symptoms
that led us to suspect a PyV-associated aetiology.
Forty-four samples were screened for the presence of PyV
sequences by using degenerate primers targeted to the VP1
structural gene in a broad-spectrum PCR assay (Johne et al.,
2005). Upon analysis on agarose gel, only one sample,
originating from Bolivian squirrel monkey Squi0106,
showed a band of approximately 250 bp. The band was
excised from the gel and the fragment was purified.
Sequence analysis of the PCR fragment, followed by BLAST
analysis (http://www.ncbi.nlm.nih.gov/BLAST/), confirmed that this animal had been infected with a PyV.
The nucleotide BLAST (BLASTN) search gave the highest score
with the MPtV strain Kilham VP1 gene (48 of 53 nt; 90 %
identity). MPtV also scored best in the protein BLAST search
(54 of 85 identical amino acids; 63 % identity), followed by
BoPyV and ChPyV. Thus, squirrel monkey Squi0106 was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
131
E. J. Verschoor and others
Table 1. DNA samples from New World monkeys used in this study
Family (subfamily)
Atelidae
Atelinae
Pitheciidae
Pitheciinae
Cebidae
Cebinae
Aotinae
Callitrichinae
Species
Common name
n*
Ateles fusciceps
Ateles sp.
Brown-headed spider monkey
Spider monkey
2
1
Pithecia pithecia
White-faced saki
1
Cebus apella
Saimiri boliviensis
Saimiri sp.
Aotus trivirgatus
Callimico goeldii
Callithrix geoffroyi
Callithrix jacchus
Callithrix penicillata
Callithrix pygmaea
Callithrix sp.
Leontopithecus chrysomelas
Saguinus bicolor
Saguinus imperator
Saguinus labiatus
Saguinus oedipus
Tufted capuchin
Bolivian squirrel monkey
Squirrel monkey sp.
Northern grey-necked owl monkey
Goeldi’s monkey
Geoffroy’s tufted-eared marmoset
Common marmoset
Black tufted-eared marmoset
Pygmy marmoset
Marmoset sp.
Golden-headed lion tamarin
Bare-faced tamarin
Emperor tamarin
Red-bellied tamarin
Cotton-top tamarin
3
8
2
2
1
6
3
2
2
2
2
1
1
2
3
*Number of individuals.
infected with a PyV that was distinct from all mammalian
and avian PyV sequences deposited in GenBank.
accommodates a large T antigen-encoding region. The
splice-donor and -acceptor sites, necessary to create the
large T antigen ORF from the early-region mRNA, were
Amplification and sequence analysis of the
complete PyV genome
To characterize this novel virus further, attempts were
made to amplify the remaining part of the genome. We
designed a set of primers on the sequence of the initial VP1
PCR product (Supplementary Table S1). The primers were
directed outwards from the VP1 fragment and thus were
designed to amplify, in a nested long PCR, the remainder
of the circular PyV genome. Following amplification, a
band of approximately 5 kb was visualized on an agarose
gel. After purification from the gel, the fragment was
cloned by TA cloning in the pGEM-T easy vector and
sequenced by using a primer-walking strategy.
The sequence represented a nearly full-length genome
sequence, lacking only a short VP1 sequence. A contig
representing the complete genome of this PyV was
obtained when the initial 0.25 kb VP1 sequence was
aligned with the 5 kb fragment. The deduced consensus
sequence of the viral genome was 5075 bp long.
Examination of putative open reading frames (ORFs)
showed that the genome of SquiPyV has a typical PyV
structure (Fig. 1). The location of the ORFs on the viral
genome and the characteristics of the deduced amino acid
sequences are listed in Table 2. SquiPyV contains an early
region with an ORF for the small T antigen, and
132
Fig. 1. Genome organization of SquiPyV. Arrows indicate the
ORFs of the VP1, VP2 and VP3 structural proteins, T antigen nonstructural proteins and the putative agnoprotein (Agno).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
Journal of General Virology 89
Characterization of squirrel monkey polyomavirus
Table 2. Proteins encoded by SquiPyV
Protein
VP1
VP2
VP3
Small T antigen
Large T antigen
Agnoprotein
Coding region (nt)
1718–2791
778–1776
1153–1776
4584–5075
4839–5075, 2831–4561
504–716
Length Molecular
(aa)
mass (kDa)
357
332
207
163
655
70
39.9
36.6
23.9
19.0
75.1
7.8
determined by using the splice-site prediction program
NNSPLICE version 0.9 (http://www.fruitfly.org/seq_tools/
splice.html) (Reese et al., 1997). When using the splicedonor site AGAAGAGGTTTGTAA (nt 4845–4831) and
splice-acceptor site GTAAGCTTTTCTGTTTTTTAGATTCCTACTTATGGTTCTGC (nt 4581–4542), the earlyregion mRNA is spliced into a large T ORF encoding a
protein of 655 aa. No evidence was found by using this
program for the existence of a middle T-encoding region.
The late region contains the ORFs for the structural
proteins VP1, VP2 and VP3. The VP2/3 and VP1 ORFs
have lengths of 999 and 1074 bp, respectively, which agrees
with the length of the structural proteins from other PyVs.
The VP3 ORF encodes a VP3 protein that is relatively small
compared with other VP3 proteins (207 aa). The difference
in length is mainly due to the fact that the deduced
SquiPyV VP2/3 proteins, like murine PyV VP2/3, terminate almost immediately behind the nuclear-localization
signal and therefore do not contain the DNA-binding
domain present in other primate and avian PyV VP2/3
proteins (Fig. 2).
Characterization of a putative agnoprotein ORF
The primate PyVs JCV, BKV, SV40 and SA12 all encode a
sixth protein, the agnoprotein, which facilitates the
localization of VP1 and enhances cell-to-cell spread. The
agnogenes of these viruses all encode highly basic proteins
(pI 10.6) of 62–72 aa (Jay et al., 1981). The agnoproteins
have a high degree of sequence conservation in the
N-terminal and central domains (Khalili et al., 2005). We
analysed the region 59-proximal to the VP2 gene for an
additional small ORF, which could encode a protein with
similar characteristics. An ORF encoding a highly basic
(pI 10.09) protein of 70 aa was located in the early region
at nt 504–716, just upstream of the start of the VP2 gene
(Table 2). Despite its resemblance in size and pI,
comparison of the agnoproteins from the primate viruses
with this hypothetical gene showed only a relatively limited
match. Amino acid similarity scores were 31.5, 38.9, 39.2
and 39.7 % with the agnoproteins of SV40, BKV, JCV and
SA12, respectively. In Fig. 3, the alignment of the
hypothetical SquiPyV agnoprotein with the other primate
proteins is shown.
The SquiPyV regulatory region
The most variable region of the PyV genome is the noncoding regulatory region. The regulatory region of SquiPyV
is situated between the small T and VP2/3 genes on the
viral genome (Fig. 4). Several sequences that are characteristic for PyV regulatory regions can also be recognized on
the SquiPyV genome. The minimum sequence of the origin
of replication (ori) (Deyerle et al., 1989) includes a 15 bp
palindromic sequence (GAGGCTTcAAGCCTC), three T
antigen-binding motifs (GAGGC) and an A/T-rich stretch
containing three TATA box sequences (nt 72–101). Two
TATA boxes are directed forward and may involve
transcription of late genes; the other has a reversed
orientation. Two additional T antigen-binding motifs that
are both in the reversed orientation are present 59 of ori
(nt 31–35 and 42–46), and may function in the regulation
of early mRNA synthesis. Other alleged TATA boxes are
found downstream of ori at nt 281–289, 319–325 and
341–348.
The regulatory regions of primate PyVs contain large,
repeated sequences and multiple binding sites for transcription factors such as Sp1, NF-1 and AP-1 (Turner &
Woodworth, 2001). No large, repeated sequences are
present in the regulatory region of SquiPyV, but a short,
repeated sequence of 12 bp is found at nt 417–440. In
addition, a number of transcription factor-binding sites are
present in the regulatory region of SquiPyV (Fig. 4).
Fig. 2. Alignment of the C-terminal end of VP3 from SquiPyV and other mammalian PyVs. Amino acid similarities and identities
are shaded dark grey and light grey, respectively. Boxes indicate conserved domains. NLS, Nuclear-localization signal; DBD,
DNA-binding domain.
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
133
E. J. Verschoor and others
Fig. 3. Alignment of the agnoproteins from the primate PyVs BKV, JCV, SA12, SV40 and SquiPyV. Amino acid similarities and
identities are shaded dark grey and light grey, respectively.
Prevalence of SquiPyV infection in squirrel
monkeys
To assess the prevalence of SquiPyV infection of squirrel
monkeys, we designed PCR primers that targeted the
SquiPyV large T antigen region specifically (see
Supplementary Table S1, available in JGV Online). We
reanalysed the spleen DNA samples of squirrel monkeys
with this nested set of primers. The animals were unrelated
and had been housed in different institutes. Five of 10
samples from Saimiri sp. tested positive in this assay (data
not shown). Sequence analysis of the purified PCR
fragments confirmed infection with SquiPyV in all five
animals. Alignment of the sequences with that derived
from animal Squi0106 revealed one nucleotide difference
in the large T fragment of a single animal, suggesting that
squirrel monkeys from different sources are infected with a
highly similar PyV (see Supplementary Fig. S1, available in
JGV Online). No positive results were obtained when we
analysed the DNA samples from other New World monkey
species by using the SquiPyV-specific PCR primers.
Phylogenetic relationship of SquiPyV to other
PyVs
A phylogenetic analysis using the VP1 genes from avian
and mammalian PyVs was done in order to evaluate the
evolutionary relationships between them (Fig. 5). VP1 was
selected because this allowed us to incorporate ChPyV in
our analysis. Gaps were removed by using the GapStreeze
program with the option to delete gaps in triplets to
preserve codons. The optimal evolutionary model to
analyse this dataset was estimated by using MODELTEST
v. 3.7 (Posada & Crandall, 1998). The optimal maximumlikelihood tree was determined by using the GTR+I+C
model and a heuristic search using the nearest-neighbour
interchange followed by the tree bisection–reconnection
branch-swapping algorithm. Neighbour-joining bootstrap
analysis for 1000 replicates was performed by using the
maximum-likelihood settings.
In the tree, all avian PyVs (finch, goose, crow and avian
PyVs) form a branch separate from the mammalian PyVs.
The mammalian PyVs are subdivided in two lineages. One
well-supported lineage includes the four human viruses
and those characterized from baboons (SA12) and
macaques (SV40) (85 % bootstrap support). The two
recently discovered human viruses KI and WU, although
related, form a distinct subcluster within this lineage
(100 % bootstrap support). SquiPyV lies on the other
branch, together with the remaining mammalian PyVs.
Bootstrap analysis supported only the small clusters
formed by the rodent viruses and those isolated from
African green monkeys (87 and 100 % bootstrap support,
Fig. 4. Regulatory region of SquiPyV. Shaded
boxes indicate the origin of replication and the
12 bp repeated sequence. Open boxes indicate TATA boxes. Transcription factor-binding
sites are underlined. Arrows indicate large T
antigen-binding sites. The palindromic
sequence within the origin of replication is
specified.
134
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
Journal of General Virology 89
Characterization of squirrel monkey polyomavirus
Fig. 5. Maximum-likelihood tree showing the
relationships of avian and mammalian PyVs,
based on analysis of the VP1 genes. SquiPyV
is accentuated in bold. Numbers on branches
are the result of 1000 bootstrap samplings.
GenBank accession numbers are indicated.
Bar, 0.1 nucleotide replacements per site.
respectively). SquiPyV, but also viruses from chimpanzees
and cattle, form separate lineages within the group of PyVs
found in mammals.
DISCUSSION
Research on PyVs has focused primarily on three viruses
found in humans, JCV, BKV and SV40, because of their
ability to cause serious diseases or their tumorigenic
potential. Two recently characterized human PyVs may
be the causative agents of acute respiratory infections, but
several other, seemingly non-pathogenic PyVs have been
described from non-human primates (Cantalupo et al.,
2005; Johne et al., 2005; Pawlita et al., 1985; Takemoto
et al., 1982). We have focused our search for novel primate
PyVs on New World primates, with an emphasis on species
used in biomedical research. This effort resulted in the
characterization of the first PyV isolated from a New
World monkey host, the squirrel monkey.
SquiPyV has a typical PyV genome organization, including
a small ORF directly 59 of the VP2/VP3 gene that could
encode an agnoprotein. The possession of an agnogene is
characteristic for the JCV/BKV/SA12/SV40 subgroup of
primate viruses (Khalili et al., 2005). The SquiPyV
agnoprotein has limited sequence similarity to the other
primate agnoproteins, but it meets the general characteristics of agnoproteins, as it is highly basic and has a length
of 70 aa (Jay et al., 1981). In contrast, the supposed
agnoproteins from BoPyV and budgerigar fledgling disease
http://vir.sgmjournals.org
virus meet none of these characteristics, implying that this
small ORF may well encode a primate agnoprotein.
SquiPyV is genetically related most closely to BoPyV and
is separated from the JCV/BKV/SA12/SV40 subcluster. The
possession of an agnogene is not limited to specific lineages
in the tree, but instead it is present in genomes of distantly
related PyVs. One could hypothesize that agnogenes are
remnants of the ancestral viruses that are conserved in
these specific, but not necessarily closely related, PyVs.
Primate PyVs show a remarkable degree of sequence
variation. Indeed, BLASTN analysis of SquiPyV genes
presented only very limited identity over short stretches
with other PyV sequences deposited in GenBank. Only
when a protein BLAST search was performed did SquiPyV
proteins show moderate identities (50–55 %) with other
PyVs, suggesting that functional constraints on the proteins
have limited evolution, while allowing abundant synonymous mutations in the viral genome. The detection of novel
PyVs is accordingly hampered by their genomic variation.
Serological detection assays can make use of the crossreactivity of antibodies induced to a specific, but
unidentified, PyV. However, PCR-based methods to
characterize viruses molecularly are intrinsically limited
to the knowledge of already-known viruses. The broadspectrum PCR primers used to detect SquiPyV were
designed by Johne et al. (2005) and were based on an
alignment of VP1 genes from both avian and mammalian
viruses. Despite this, we could only detect the novel virus in
animal Squi0106, whereas SquiPyV in the other infected
squirrel monkeys was detected only after the use of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
135
E. J. Verschoor and others
SquiPyV-specific large T primers. All large T PCR
fragments obtained from various animals were highly
similar (see Supplementary Fig. S1, available in JGV
Online). This points to a limited inter-animal variability
of the virus, and indicates that the broad-spectrum VP1
PCR assay lacks sensitivity.
Butel, J. S., Vilchez, R. A., Jorgensen, J. L. & Kozinetz, C. A. (2003).
SquiPyV is a PyV that infects squirrel monkeys naturally
and does not represent an isolated case of interspecies
transmission. Use of PCR assays to monitor the incidence
of SquiPyV infections in squirrel monkeys inherently leads
to an underestimation compared with serological tests, but
despite this, a 50 % infection rate was found. This is in line
with serosurveys of other PyV infections in primates, where
seropositivity rates exceed 50 % (Braun et al., 1980;
Ichikawa et al., 1987; Valis et al., 1977).
Polio vaccines, simian virus 40, and human cancer: the epidemiologic
evidence for a causal association. Oncogene 23, 6535–6540.
The AIDS epidemic of the last three decades, the increasing
number of tissue transplantations and the development of
drugs that specifically target components of the immune
system have placed a focus on PyVs and their pathogenic
potential due to reactivation (Khalili et al., 2007;
Owczarczyk et al., 2007; Yousry et al., 2006). Non-human
primates, infected either naturally or experimentally with
PyVs, may be valuable animal models to investigate
processes of viral reactivation that can lead to PML or
PVAN. Zaragoza et al. (2005) investigated the use of
squirrel monkeys as an animal model for human PyV
infection by inoculating them experimentally with BKV
and SV40. The discovery of a native SquiPyV emphasizes
the necessity to use animals with a well-described viral
status. Currently, the natural occurrence of PyVs in nonhuman primates used in animal research has scarcely been
investigated. However, the intended use of primates for
PyV research and, more generally, the potential zoonotic
hazard of working with non-human primates that are
infected naturally with PyVs requires the development of
screening tools for PyV infection and research regarding
the biology of PyVs. This is the first article reporting the
natural occurrence of a PyV in squirrel monkeys, and
represents a step towards characterization of PyVs in nonhuman primates used in biomedical research.
Association between SV40 and non-Hodgkin’s lymphoma. Leuk
Lymphoma 44 (Suppl. 3), S33–S39.
Cantalupo, P., Doering, A., Sullivan, C. S., Pal, A., Peden, K. W.,
Lewis, A. M. & Pipas, J. M. (2005). Complete nucleotide sequence of
polyomavirus SA12. J Virol 79, 13094–13104.
Dang-Tan, T., Mahmud, S. M., Puntoni, R. & Franco, E. L. (2004).
Deyerle, K. L., Sajjadi, F. G. & Subramani, S. (1989). Analysis of origin
of DNA replication of human papovavirus BK. J Virol 63, 356–365.
Eddy, B. E., Borman, G. S., Grubbs, G. E. & Young, R. D. (1962).
Identification of the oncogenic substance in rhesus monkey kidney
cell culture as simian virus 40. Virology 17, 65–75.
Elmishad, A. G., Bocchetta, M., Pass, H. I. & Carbone, M. (2006).
Polio vaccines, SV40 and human tumours, an update on false positive
and false negative results. Dev Biol (Basel) 123, 109–117.
Engels, E. A., Switzer, W. M., Heneine, W. & Viscidi, R. P. (2004).
Serologic evidence for exposure to simian virus 40 in North American
zoo workers. J Infect Dis 190, 2065–2069.
Gardner, S. D., Field, A. M., Coleman, D. V. & Hulme, B. (1971). New
human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1, 1253–1257.
Gaynor, A. M., Nissen, M. D., Whiley, D. M., Mackay, I. M., Lambert,
S. B., Wu, G., Brennan, D. C., Storch, G. A., Sloots, T. P. & Wang, D.
(2007). Identification of a novel polyomavirus from patients with
acute respiratory tract infections. PLoS Pathog 3, e64.
Girardi, A. J., Sweet, B. H., Slotnick, V. B. & Hilleman, M. R. (1962).
Development of tumors in hamsters inoculated in the neonatal period
with vacuolating virus, SV-40. Proc Soc Exp Biol Med 109, 649–660.
Graffi, A., Schramm, T., Graffi, I., Bierwolf, D. & Bender, E. (1968).
Virus-associated skin tumors of the Syrian hamster: preliminary note.
J Natl Cancer Inst 40, 867–873.
Gross, L. (1953). A filterable agent, recovered from Ak leukemic
extracts, causing salivary gland carcinomas in C3H mice. Proc Soc Exp
Biol Med 83, 414–421.
Ichikawa, T., Minamoto, N., Kinjo, T., Matsubayashi, N.,
Matsubayashi, K. & Narama, I. (1987). A serological survey of simian
virus 40 in monkeys. Microbiol Immunol 31, 1001–1008.
Jay, G., Nomura, S., Anderson, C. W. & Khoury, G. (1981).
Identification of the SV40 agnogene product: a DNA binding protein.
Nature 291, 346–349.
Johne, R., Enderlein, D., Nieper, H. & Muller, H. (2005). Novel
polyomavirus detected in the feces of a chimpanzee by nested broadspectrum PCR. J Virol 79, 3883–3887.
ACKNOWLEDGEMENTS
Khalili, K., White, M. K., Sawa, H., Nagashima, K. & Safak, M. (2005).
This study was supported by the European Community Research
Infrastructures Program grant RII3-CT-2006-026155 ‘European
Primate Network: Specialized Infrastructures and Procedures for
Biological and Biomedical Research (EUPRIM-NET)’.
The agnoprotein of polyomaviruses: a multifunctional auxiliary
protein. J Cell Physiol 204, 1–7.
Khalili, K., White, M. K., Lublin, F., Ferrante, P. & Berger, J. R. (2007).
Reactivation of JC virus and development of PML in patients with
multiple sclerosis. Neurology 68, 985–990.
Owczarczyk, K., Hilker, R., Brunn, A., Hallek, M. & Rubbert, A. (2007).
REFERENCES
Allander, T., Andreasson, K., Gupta, S., Bjerkner, A., Bogdanovic, G.,
Persson, M. A., Dalianis, T., Ramqvist, T. & Andersson, B. (2007).
Progressive multifocal leucoencephalopathy in a patient with
sarcoidosis – successful treatment with cidofovir and mirtazapine.
Rheumatology (Oxford) 46, 888–890.
Identification of a third human polyomavirus. J Virol 81, 4130–4136.
Padgett, B. L., Walker, D. L., ZuRhein, G. M., Eckroade, R. J. & Dessel,
B. H. (1971). Cultivation of papova-like virus from human brain with
Braun, L., Kalter, S. S., Yakovleva, L. A., Kaschula, V. R. & Shah, K. V.
(1980). Neutralizing antibodies to simian papovavirus SA12 in Old
Pawlita, M., Clad, A. & zur Hausen, H. (1985). Complete DNA
World primates in laboratory colonies: high prevalence in baboons.
J Med Primatol 9, 240–246.
sequence of lymphotropic papovavirus: prototype of a new species of
the polyomavirus genus. Virology 143, 196–211.
136
progressive multifocal leucoencephalopathy. Lancet 1, 1257–1260.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
Journal of General Virology 89
Characterization of squirrel monkey polyomavirus
MODELTEST: testing the model of
DNA substitution. Bioinformatics 14, 817–818.
Posada, D. & Crandall, K. (1998).
Takemoto, K. K., Furuno, A., Kato, K. & Yoshiike, K. (1982).
Poulin, D. L. & DeCaprio, J. A. (2006). Is there a role for SV40 in
Biological and biochemical studies of African green monkey
lymphotropic papovavirus. J Virol 42, 502–509.
human cancer? J Clin Oncol 24, 4356–4365.
Turner, W. J. & Woodworth, M. E. (2001). DNA replication efficiency
Rambaut, A. (1996). Se-Al: Sequence Alignment Editor version 1.0a1.
depends on transcription factor-binding sites. J Virol 75, 5638–5645.
Distributed by the author. Oxford: Department of Zoology,
University of Oxford. http://evolve.zoo.ox.ac.uk/
Valis, J. D., Newell, N., Reissig, M., Malherbe, H., Kaschula, V. R. &
Shah, K. V. (1977). Characterization of SA12 as a simian virus
Reese, M. G., Eeckman, F. H., Kulp, D. & Haussler, D. (1997).
40-related papovavirus of chacma baboons. Infect Immun 18,
247–252.
Improved splice site detection in Genie. J Comput Biol 4, 311–323.
Schneider, H. (2000). The current status of the New World monkey
phylogeny. An Acad Bras Cienc 72, 165–172.
Schuurman, R., Sol, C. & van der Noordaa, J. (1990). The complete
nucleotide sequence of bovine polyomavirus. J Gen Virol 71, 1723–1735.
Shah, K. V. (1966). Neutralizing antibodies to simian virus 40 (SV40)
in human sera from India. Proc Soc Exp Biol Med 121, 303–307.
Sweet, B. H. & Hilleman, M. R. (1960). The vacuolating virus, S.V. 40.
White, M. K., Gordon, J., Reiss, K., Del Valle, L., Croul, S., Giordano, A.,
Darbinyan, A. & Khalili, K. (2005). Human polyomaviruses and brain
tumors. Brain Res Brain Res Rev 50, 69–85.
Yousry, T. A., Major, E. O., Ryschkewitsch, C., Fahle, G., Fischer, S.,
Hou, J., Curfman, B., Miszkiel, K., Mueller-Lenke, N. & other authors
(2006). Evaluation of patients treated with natalizumab for progress-
ive multifocal leukoencephalopathy. N Engl J Med 354, 924–933.
Proc Soc Exp Biol Med 105, 420–427.
Zaragoza, C., Li, R. M., Fahle, G. A., Fischer, S. H., Raffeld, M., Lewis,
A. M., Jr & Kopp, J. B. (2005). Squirrel monkeys support replication of
Swofford, D. L. (2002).
PAUP*: phylogenetic analysis using parsimony
(*and other methods), v. 4.0b10. Sunderland, MA: Sinauer Associates.
BK virus more efficiently than simian virus 40: an animal model for
human BK virus infection. J Virol 79, 1320–1326.
Takemoto, K. K. & Segawa, K. (1983). A new monkey lymphotropic
zur Hausen, H. & Gissmann, L. (1979). Lymphotropic papovaviruses
isolated from African green monkey and human cells. Med Microbiol
Immunol 167, 137–153.
papovavirus: characterization of the virus and evidence of a related
virus in humans. Prog Clin Biol Res 105, 87–96.
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 18:11:25
137