The Schizosaccharomyces pombe spo6‡ gene encoding
a nuclear protein with sequence similarity to budding
yeast Dbf4 is required for meiotic second division and
sporulation
Tomohiro Nakamuraa, Masao Kishidab and Chikashi Shimoda*
Department of Biology, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585, Japan
Abstract
Background: Sporulation of the ®ssion yeast Schizosaccharomyces pombe is a cell differentiation process
which accompanies meiosis. The spo6‡ gene was
identi®ed as a sporulation-speci®c gene, whose
transcription was regulated by the forkhead family
transcription factor Mei4.
Results: spo6‡ encodes a protein with sequence
similarity to Saccharomyces cerevisiae Dbf4p, which is
required for the initiation of DNA replication.
However, doubling time and cell morphology of
spo6 deletion mutants and spo6-cDNA over-expressing cells were indistinguishable from wild-type
cells. Spliced mature mRNAs of spo6‡ appeared
when diploid cells committed to meiosis. Spo6p
fused to green ¯uorescent protein (GFP) preferentially localized in a nucleus. Although spo6D
Introduction
The gametogenesis of multicellular organisms accompanies haploidization by meiotic nuclear division and
the cellular specialization suitable for fertilization. For
example, in the process of spermatogenesis in metazoa,
haplontic spermatids are produced by meiosis from
spermatocytes and then differentiate into motile
spermatozoa equipped with head and tail structures. A
corresponding process in lower eukaryotes is ascospore
Communicated by: Masayuki Yamamoto
*Correspondence: E-mail: [email protected]
Present addresses: aDepartment of General Education,
Osaka Institute of Technology, Omiya, Asahi-ku, Osaka
535-8585; bDepartment of Applied Biochemistry, College
of Agriculture, Osaka Prefectural University, Sakai, Osaka
599-8531, Japan.
q Blackwell Science Limited
diploids normally underwent premeiotic DNA
replication and meiosis-I, approximately 80% of
cells were blocked at the binucleate stage during
meiosis and virtually no asci were formed. Antitubulin staining revealed that only 25% of the
binucleate cells assembled spindle microtubules for
meiosis-II. In a small number of tetranucleate cells,
sister nuclei insuf®ciently separated and spindles
were frequently fragmented. The meiosis-II arrest
phenotype was exaggerated at low temperature and
in the presence of caffeine.
Conclusions: These results indicate that Spo6p is a
novel Dbf4-related nuclear protein, which is
expressed during meiosis and is indispensable for
normal progression of meiosis-II and sporulation.
formation that accompanies meiosis prior to sporulation. The yeast spore is a highly specialized cell form
which is characterized by dormancy and resistance to a
wide range of environmental stresses (Egel 1977;
Esposite & Klapholz 1981; Yamamoto et al. 1997).
Spatial and temporal coupling between meiotic events
and cell specialization processes during gametogenesis
appears to be indispensable not only in higher
organisms, but also in yeasts.
The ®ssion yeast Schizosaccharomyces pombe, one of the
typical laboratory organisms, proliferates by binary
®ssion in a haploid state, and enters sexual differentiation when available nutrients, especially nitrogen
sources, are exhausted (Egel 1971, 1989; Yamamoto
et al. 1997). Haploid cells of different mating types,
designated as h‡ and h , conjugate to form diploid
zygotes which immediately undergo meiosis (Egel
1989; Yamamoto et al. 1997). Yeast meiosis is basically
Genes to Cells (2000) 5, 463±479
463
T Nakamura et al.
similar to higher eukaryotic meiosis in that it proceeds
through a single round of DNA replication (premeiotic
DNA replication) and then two successive rounds of
nuclear division, resulting in the reduction of the
chromosome number. Although a typical tripartite
synaptonemal complex is not observable in ®ssion yeast
(Olson et al. 1978), this yeast shares many fundamental
characteristics with higher eukaryotes; e.g. pairing of
homologous chromosomes and extensive recombination during prophase-I (Egel 1989; Yamamoto et al.
1997). S. pombe diploid cells ®nally culminate in asci,
each containing four haploid ascospores. The sporulation process begins with the fusion of endoplasmic
reticulum-derived membrane vesicles, near cytoplasmic
side of spindle pole bodies (SPBs) during meiosis-II
(Hirata & Tanaka 1982; Tanaka & Hirata 1982). This
double-layered membrane called `forespore membrane',
®nally engulfs individually four haploid nuclei and
develops into a new cell envelope of spores. The SPBs
in meiosis-II are modi®ed to the structure with a
multilayered outer plaque (Hirata & Tanaka 1982;
Tanaka & Hirata 1982). This structural modi®cation of
SPBs is a prerequisite for the assembly of forespore
membranes (Hirata & Shimoda 1994). SPBs have dual
functions during meiosis-II, organization of spindle
microtubules and assembly of forespore membranes.
This means that SPB is a crucial structure which
coordinates meiotic nuclear division with ascospore
formation.
Numerous sporulation-de®cient mutants of S. pombe
have been isolated and genetically characterized (Bresch
et al. 1968; Kishida & Shimoda 1986). Several mutants
are defective in meiosis-I or meiosis-II, abbreviated as
mei and mes, respectively (Bresch et al. 1968; Shimoda
et al. 1985). In addition, sporulation-de®cient mutants
have also been isolated, in which two rounds of
consecutive meiotic nuclear divisions complete in a
considerable proportion of the cell population. Genetic
analysis has determined 20 loci, spo1±spo20, which
might encode proteins speci®cally involved in sporulation (Bresch et al. 1968; Kishida & Shimoda 1986). In
addition, a mutant of calmodulin, cam1-F116, was
speci®cally defective in sporulation (Takeda et al. 1989).
Serial-section electron microscopic analysis has
revealed an intriguing feature of the spo6 mutant
(Hirata & Shimoda 1992). A small fraction of the
mutant cells, 20±40%, reach a tetranucleate stage, while
the resulting haploid nuclei are not enveloped by
forespore membranes. After meiosis-II, SPBs abnormally dissociate from the nuclear envelopes, thus
sometimes spore-like bodies that fail to encapsulate a
nucleus are produced in the ascal cytoplasm (Hirata &
464
Genes to Cells (2000) 5, 463-479
Shimoda 1992). spo6‡ is speci®cally transcribed during
meiosis and is one of the identi®ed targets of a forkhead
family transcription factor Mei4 (Horie et al. 1998; Abe
& Shimoda 2000). To elucidate the function of the
spo6‡ gene product, we cloned and analysed spo6‡ in
the present study. The spo6‡ gene encodes a protein
with a sequence similar to the budding yeast Dbf4p
(Chapman & Johnston 1989; Kitada et al. 1992) and
its ®ssion yeast counterpart Dfp1p/Him1p/Rad35p
(Brown & Kelly 1998; Brown & Kelly 1999; Takeda
et al. 1999). S. cerevisiae Dbf4p is a regulatory subunit of
the Cdc7 serine/threonine protein kinase (Jackson et al.
1993). Cdc7p-Dbf4p binds to a pre-replication complex (Dowell et al. 1994) and initiates DNA replication
by phosphorylating some MCM proteins, which are
components of the complex (Lei et al. 1997). Hsk1pDfp1p is the homologous protein complex in S. pombe
(Masai et al. 1995; Brown & Kelly 1998). The fact that
Spo6p seems to be a homologue of Dbf4p and that the
spo6 mutation causes some defect in meiosis prompted
us to examine the possibility that Spo6p is a meiosisspeci®c counterpart of Dfp1p. In this article, we report
essential roles of Spo6p for meiotic second division as
well as sporulation.
Results
Cloning and sequencing of spo6‡
To elucidate the molecular function of the spo6‡ gene
product, we isolated spo6‡ from an S. pombe genomic
library (Shimoda & Uehira 1985) by functional
complementation. As a result, the 4.6-kb HindIII
fragment which could complement the spo6-B79
mutation was cloned (Fig. 1A). Integration mapping
revealed that the cloned DNA contained the genetically
de®ned spo6‡ gene itself, but not a multicopy
suppressor gene (see Experimental procedures).
Subcloning localized spo6‡ on the 2.6-kb HindIII/
BglII fragment (Fig. 1A) and its nucleotide sequence was
determined (Accession number AB020809). The
identical sequence was found in the cosmid c1778
which was recently registered in the S. pombe genome
sequence database (The Sanger Centre, UK; Gene
name, SPBC1778.04; Accession number CAB39799).
The comparison of this genomic sequence with partial
sequences of the corresponding cDNA clones shows
that the spo6‡ open reading frame (ORF) is split by
three introns of 51-, 46- and 45-bp (Fig. 1A). The 50
and 30 splice sites of the three introns of spo6‡ have the
same sequences, GTAAGT and TAG, respectively. The
sequences of these splice junctions match the consensus
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
Figure 1 Structure of the spo6‡ gene and its disruption. (A) The restriction map, subcloning and disruption construct.
Complementation of spo6-B79 by each subclone: ‡, complements; , does not complement. Restriction enzymes: H, HindIII; X,
XbaI; S, SalI; C, ClaI; Bg, BglII. (B) Southern analysis of putative disruptants. Genomic DNA isolated from NT-1 J (lane 1), NT-1D
(lane 2) and JY878 (lane 3) was digested with HindIII and probed with the 32P-labelled 4.3-kb HindIII fragment containing spo6‡.
sequences proposed for S. pombe introns, GTANG for
the 50 splice site and YAG for the 30 one (Russell 1989;
Kishida et al. 1994). The sequence data implies that the
spo6‡ gene potentially encodes a 55-kDa protein
composed of 474 amino acids (Fig. 2A).
Spo6p is homologous to S. pombe Dfp1p and
S. cerevisiae Dbf4p
The predicted amino acid sequence of Spo6p was
sought for homology with known proteins in databases.
Interestingly, Spo6p shows a signi®cant sequence
similarity with S. pombe Dfp1p (Brown & Kelly 1998;
Takeda et al. 1999) and S. cerevisiae Dbf4p (Kitada et al.
1992) (Fig. 2A). Spo6p shares 32% identity and 47%
similarity with Dfp1 throughout the protein. Dfp1p is
an S. pombe homologue of S. cerevisiae Dbf4p, which is a
regulatory subunit of Cdc7 protein kinase (Jackson et al.
1993). Dbf4-related proteins identi®ed in yeasts,
Drosophila, mouse and human are supposed to be
functionally conserved. Although overall homology is
q Blackwell Science Limited
not so high, there are two conserved regions, named
motif-N and motif-C, in these protein families (Kumagai
et al. 1999). As shown in Fig. 2(B), Spo6p contains
sequences similar to both motif-N and motif-C. Dbf4p
¯uctuates during the cell cycle and reaches its maximum
accumulation in the S phase (Cheng et al. 1999; Oshiro
et al. 1999). Degradation of Dbf4p in the late M phase
to G1 phase is mediated by the anaphase promoting
complex (Cheng et al. 1999; Oshiro et al. 1999;
Ferreira et al. 2000). Two putative destruction boxlike sequences, RSPLKETDT and RLELQQQQH,
were found in the N-terminal region of Dbf4p (Cheng
et al. 1999). Spo6p also contained a potential destruction
box, RSPLVDQNP, in the amino-terminus (Fig. 2B).
These structural features suggest that Spo6p is a Dbf4related protein.
Dbf4p associates with Cdc7p serine/threonine kinase
and plays an indispensable role in the initiation of DNA
replication (Jackson et al. 1993). Hsk1 has been
identi®ed as the S. pombe homologue of Cdc7p (Masai
et al. 1995). Hsk1p has protein kinase activity, and the
Genes to Cells (2000) 5, 463±479
465
T Nakamura et al.
Figure 2 The predicted spo6‡ gene
product is a protein similar to S. cerevisiae
Dbf4p. (A) Amino acid sequence alignment among Spo6p and Dfp1 of S. pombe,
and Dbf4p of S. cerevisiae. Identical amino
acid residues are shown in black boxes and
similar residues are shaded in grey. (B)
Structure of Spo6p and comparison of its
predicted amino acid sequences in motifN and motif-C with other Dbf4 family
proteins including HuHSK (human),
MuASK (mouse) and DmAsk (Drosophila
melanogaster) (Kumagai et al. 1999). The
potential destruction box and nuclear
localization signal (NLS) are indicated.
association with Dfp1p is required for its full activity on
exogenous substrates (Brown & Kelly 1999; Takeda et al.
1999). It is an attractive hypothesis that Spo6p and
Dfp1p are twin regulatory subunits for Hsk1p, the
former functioning during meiosis and the latter during
mitosis. To examine whether Spo6p interacts with
Hsk1p, the two-hybrid analysis was conducted. A Gal4
466
Genes to Cells (2000) 5, 463-479
activation domain was fused to either Spo6p or Dfp1p
in a multicopy plasmid. S. cerevisiae recipient strains were
co-transformed with a Gal4 DNA-binding domain/
Hsk1p fusion (see Experimental procedures). We could
not detect signi®cant b-galactosidase activity with the
Hsk1p-Spo6p combination, though a positive control,
Hsk1p-Dfp1p, gave a strong signal (data not shown). We
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
Figure 2 Continued.
then examined whether or not the ectopic overproduction of spo6‡ rescues the growth defect of him1D
[him1‡ is the same gene as dfp1‡ which was isolated
independently by Takeda et al. (1999)]. A him1D
heterozygous diploid was transformed with pREP(spo6)
and then sporulated. Spores were spread on a minimal
medium with supplements. No him1D colonies were
recovered, although a plenty of him1‡ segregants which
carried the spo6 plasmid formed colonies, indicating
that spo6‡ had no ability to complement the growth
defect of him1D (data not shown). Conversely, him1‡
over-expressed in spo6 mutants failed to reverse the
inability to sporulate. Thus, we could not obtain
evidence that the putative partner kinase of Spo6p is
Hsk1, even if Spo6p acts as a kinase regulator.
Expression of spo6‡ and localization of Spo6p
We detected two forms of spo6 transcripts by Northern
analysis. The larger mRNA species (,2.6 kb, named
spo6-L) exists in both vegetative and meiotic cells,
whereas the smaller one (,1.7 kb, named spo6-S) is
induced only during meiosis (Fig. 3A). spo6‡ has a
binding site for Mei4 transcription factor in the 50
upstream region, and accumulation of spo6-S was
dependent upon Mei4p (Horie et al. 1998; Abe &
Shimoda 2000).
The structures of spo6-L and spo6-S were studied by
cDNA analysis. We ®rst examined whether three
q Blackwell Science Limited
introns of spo6 were spliced or not. RNA samples
prepared from vegetative and meiotic cells were
subjected to RT-PCR analysis using three sets of
primer oligonucleotides spanning every intronic
sequence. As shown in Fig. 3B, vegetative spo6
mRNA, composed exclusively of spo6-L, retained the
intervening sequences, whereas meiotic spo6 mRNA,
mainly spo6-S, proved to be a spliced mature transcript.
The uppermost band in the lane of intron II/±N was
not reproducibly detected in the similar experiments.
When genomic DNA containing spo6‡ was ectopically
expressed in vegetative cells, the introns were ef®ciently
spliced out (data not shown). This observation
suggested that splicing of spo6 mRNA was not
dependent on meiosis, but probably on the premRNA structure. Next, transcriptional start and
polyadenylation sites were assigned by the 50 - and 30 RACE method. Both 50 - and 30 -RACE fragments are
fractionated on agarose gels (Fig. 3C). Nucleotide
sequencing of these RACE fragments of spo6-S showed
that its 50 end located 175-bp upstream of the putative
initiation codon and the polyadenylation site was
mapped to 93-bp downstream of the termination
codon. A typical polyadenylation signal, AAUAAA,
exists 30-bp upstream of the poly A tail. Surprisingly,
spo6-L was transcribed in the reverse orientation; i.e.
the polyadenylation site lay in the 50 ¯anking region
of the spo6‡ ORF and the 50 end of spo6-L was mapped
in the 30 downstream region of the ORF (Fig. 3D).
Genes to Cells (2000) 5, 463±479
467
T Nakamura et al.
Figure 3 Analysis of transcripts of spo6.
(A) Northern analysis of spo6 mRNA
during meiosis and sporulation. A wildtype diploid strain, CD16-1, was incubated in SSL±N sporulation medium.
Meiotic ®rst division started around 4 h
of incubation. Poly(A)‡ RNA was prepared by oligo(dT)-cellulose column chromatography. Approximately 2 mg RNA
was applied to each lane. A 32P-labelled
2.6-kb HindIII/BglII fragment containing
spo6‡ was used as a probe. (B) RT-PCR
analysis of spo6 mRNA splicing. A wildtype h90 strain, L968, was used. Total
RNA for RT-PCR was prepared from
vegetative cells (‡ N), which had been
cultured for 18 h in YEL, and from meiotic
cells ( N), cultured for 8 h in SSL± N.
Predicted size of PCR products (spliced/
unspliced): intron-I,
302 bp/353 bp;
intron-II, 138 bp/184 bp; intron-III,
133 bp/178 bp. M1, size markers (fX174
DNA digested with HincII). G, PCR
product using genomic DNA as a template. (C) 50 and 30 -RACE analysis of the
mitotic and meiotic spo6 mRNA. A wildtype strain, L968, was cultured in MML
‡N for 15 h and then shifted to MML±N.
Total RNA was prepared at 0 h (‡ N) and
6 h ( N). Size markers used are l DNA
digested with HindIII (M2) or EcoT14I
(M3). Estimated sizes of RACE products
(‡ N/±N): 50 -RACE, 2.0 kb/1.5 kb; 30 RACE, 1.8 kb/1.4 kb (D) Transcriptional
map of the spo6 locus.
Therefore spo6-L does not encode the spo6‡ ORF. Any
ORFs longer than 100 codons do not exist in spo6-L.
The signi®cance of this transcript will be discussed later
(see Discussion).
Although our previous work (Horie et al. 1998)
468
Genes to Cells (2000) 5, 463-479
reported that the size of spo6-S was 1.4 kb, the estimate
from the present cDNA analysis was 1690 nucleotides
without poly A tail. This discrepancy in size estimation
between these two reports may be due to the use of less
accurate size markers in the previous Northern blot
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
Figure 3 Continued.
analysis. The presumptive structures of spo6-L and spo6S are illustrated in Fig. 3D.
To elucidate the subcellular localization of Spo6p,
the genomic spo6‡ gene with its authentic promoter
was fused to GFP. This fusion construct born on a
multicopy plasmid, pAL(Spo6-GFP), was introduced
into C186-6B. The transformants sporulated at a
frequency comparable to a wild-type strain (data not
shown), indicating that the Spo6-GFP fusion protein
was functional. The GFP signal was detected in nuclei
of meiotic cells, more intense in binucleate cells relative
to mono- and tetranucleate cells (Fig. 4A). The signal
was not observed in vegetative cells (data not shown).
These observations indicated that Spo6p is a nuclear
protein and is probably expressed only in meiotic cells.
Next, the in-frame fusion of GFP and the spo6
cDNA without introns was constructed on a pREP41
vector, to allow the ectopic expression of GFP-Spo6p
by the nmt1 promoter in vegetative cells. Figure 4B
shows that the GFP signal was detected in nuclei of
mitotic cells, suggesting the intrinsic nuclear localization of this protein. We found a putative nuclear
localization signal, AHKKVK, in the C-terminal
exon-3. This similar motif was demonstrated to be
essential for the nuclear transport of one of the
human proteasome subunit proteins (Nederlof et al.
1995). Whether or not this motif acts as the
nuclear localization signal of Spo6p remains to be
established.
q Blackwell Science Limited
Spo6p is required neither for vegetative
growth nor premeiotic DNA synthesis
By analogy with Cdc7p/Dbf4p, a hypothetical complex
composed of Spo6p and a still unknown protein kinase
of the Cdc7 family is supposed to be involved in DNA
replication. First, the null mutant of spo6 was generated
by conventional gene disruption (Fig. 1A,B). spo6D
disruptants formed colonies on a complete medium at
incubation temperatures ranging from 20 8C to 37 8C,
but sporulation was completely blocked on the
nitrogen-free medium. Cell division kinetics in a
liquid medium (EMM2) was compared among wildtype, spo6D and spo6‡-over-expressing strains harbouring pREP(spo6). The doubling times in hours for those
strains were 2.7 6 0.7 (wild-type), 2.8 6 0.7 (spo6D)
and 2.9 6 0.7 (spo6op). We concluded that Spo6p does
not play an essential part in mitotic cell proliferation, in
contrast to the indispensable mitotic functions of Dbf4p
and Dfp1p.
As spo6D was not able to complete sporulation, it
is possible that the spo6‡ gene product is essential
for premeiotic DNA replication. To test this possibility,
a spo6D homozygous diploid strain, NT2-JY, was
subjected to sporulation and the DNA content was
examined by ¯owcytometry (Fig. 5). After 2 h of
incubation in the nitrogen-free medium, a distinct G1
peak (2C) predominated in both wild-type and spo6D
strains. A G2 peak (4C) appeared again after 4 h of
Genes to Cells (2000) 5, 463±479
469
T Nakamura et al.
Figure 4 Nuclear localization of the
GFP-Spo6 fusion protein. (A) Localization
of Spo6-GFP in meiotic cells. The genomic spo6‡ gene fused to GFP was
constructed on a multicopy plasmid. The
transformant,
C186-6B,
carrying
pAL(Spo6-GFP) was incubated on a
synthetic sporulation plate, SSA, for 2
days. (B) Localization of GFP-Spo6p
ectopically expressed in mitotic cells. The
transformant,
NT2-JY,
carrying
pREP41(GFP-Spo6) was incubated on a
minimal medium, MMA, for 2 days.
incubation in both strains, indicating the execution of
premeiotic DNA synthesis. It is evident from this
analysis that bulk DNA replication occurs prior to
meiosis in spo6D cells.
Spo6p is essential for second meiotic division
The primary defect of spo6 mutants seems to be their
inability to sporulate. We next examined the precise
arrest phenotype of a diploid spo6D strain during
sporulation. Synchronous meiosis was induced by
transferring a log-phase culture to nitrogen-free liquid
medium (MML±N). The kinetics of meiosis at either
20 8C or 30 8C is shown in Fig. 6. While the meiotic
®rst division was a little delayed in spo6D cells relative to
470
Genes to Cells (2000) 5, 463-479
wild-type cells, the frequency of cells which completed
meiosis-I did not differ between the two strains either at
20 8C or at 30 8C. After 12 h of incubation, approximately 95% of the wild-type cells had ®nished meiosisII and eventually differentiated into spore-containing
asci. By contrast, only one-forth of the spo6D cells
completed meiosis-II and virtually no asci were formed
at 30 8C. The defect of meiosis-II in spo6D is more
severe at 20 8C, tetranucleate cells being scarcely found
(Fig. 6D). These observations indicated that spo6‡ is
necessary not only for sporulation but also for second
meiotic division.
Caffeine is known to be an inhibitor of 30 ,50 -cyclic
nucleotide phosphodiesterase. S. pombe dis1 mutants
which are defective in sister chromatid separation
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
Figure 5 Flowcytometric analysis of premeiotic DNA replication in spo6D cells. The late-log phase cells of diploid strains,
NT3-CH (wild-type) or NT2-JY (spo6D), were inoculated into
MML±N and incubated to allow premeiotic DNA synthesis. The
disappearance of 2C and 4C peaks in the wild-type strain (10 h) is
due to abundant spores in the sample.
during mitotic anaphase were supersensitive to caffeine
(Ohkura et al. 1988). As shown below, spo6D cells had a
similar defect in sister chromatid separation during
meiosis-II, so we reasoned that caffeine may exaggerate
the lesion of meiosis-II in spo6 cells. We thus examined
q Blackwell Science Limited
the effect of caffeine. As shown in Fig. 7, meiosis-II was
selectively inhibited by 5±10 mM caffeine in spo6D,
whereas caffeine at these concentrations impaired neither
®rst nor second meiotic divisions in the wild-type.
A major fraction of the spo6D homozygous diploid
cells arrested at the binucleate stage during meiosis. To
address the question of whether such binucleate cells
initiated meiosis-II, synchronized meiotic cultures were
examined by DAPI staining and indirect ¯uorescence
microscopy with an anti-tubulin antibody TAT-1
(Woods et al. 1989). The results are shown in Fig. 8
and summarized in Table 2. Tetranucleate cells were
fewer in spo6D than wild-type, though about half of the
cell population had ®nished meiosis-I in both strains at
5.5 h after the nutritional shift-down (Table 2).
Approximately one-forth of the spo6D cells in the
binucleate stage contained meiotic spindles, the proportion of this class of cells being slightly lower than that
for wild-type culture. In a wild-type culture at 10 h,
more than 90% of cells contained four nuclei and half of
them were converted to asci (cf. Figure 6A). On the
other hand, spo6D tetranucleate cells at 10 h accounted
for only 6%, and about 70% of the binucleate population
did not have spindles (Table 2). Most tetranucleate cells of
spo6D contained fragmented spindles and displayed only
poorly segregated sister nuclei (Fig. 8). Spindle
formation during meiosis-II was strongly inhibited at
20 8C in spo6D cells (Table 2). These observations imply
that the spo6 mutation impairs the normal assembly
and/or stability of meiosis-II spindles.
We further studied the meiosis-II spindles in relation
to sister nuclei separation. The length of the spindles in
meiosis-I and meiosis-II was measured quantitatively
and compared with the distance between sister nuclei
(Table 3). There were no signi®cant differences
between wild-type and spo6D strains in the average
spindle length either at metaphase-I (class-A), nor at
anaphase-I (class-B). In addition, the average distance
between a pair of sister nuclei in class-B cells was
roughly the same as in wild-type cells. By contrast, on
average, spo6D spindles were signi®cantly longer than
wild-type cells containing unseparated nuclei (class-C),
suggesting that sister chromatid separation is delayed or
inhibited in spo6D. Furthermore, the sister nuclei were
found not to be fully separated in spo6D (in class-D
cells). The ratio of DS (distance between sister nuclei) to
LS (length of spindles) is 0.72 for wild-type and 0.45 for
spo6D. These observations suggested that spo6D cells
mostly arrest before second meiotic division and the
small fraction of cells that could overcome this blockage
showed incomplete separation of sister chromatids
probably due to the spindle defects.
Genes to Cells (2000) 5, 463±479
471
T Nakamura et al.
Figure 6 Kinetics of meiosis and sporulation at 20 8C or 30 8C. Late-log phase cells of a wild-type diploid strain, NT3-CH (A and C)
and a spo6D homozygous diploid strain, NT2-JY (B and D), were incubated in MML±N. Samples were taken and immediately ®xed by
70% ethanol. The progression of meiosis was observed by DAPI staining and asci were counted under a phase-contrast microscope.
About 300 cells were counted for each sample. Incubation temperature: A and B, 30 8C; C and D, 20 8C. Symbols: Closed circles, cells
completed meiosis-I; Open circles, cells completed meiosis-II; Closed triangles, asci.
Discussion
The spo6 locus is transcribed in both directions to
generate two different mRNA species, spo6-S and spo6L (Fig. 3D). The direction of spo6-S was the same as
Spo6 ORF, but that of spo6-L was reverse. A 2.6-kb
genomic HindIII/BglII fragment, which contains the
whole Spo6 ORF but lacks the promoter region for
spo6-L, complemented spo6-B79 mutants (Fig. 1A).
Furthermore, ectopic expression of the Spo6 ORF by
nmt1 promoter suppressed the spo6 mutation (data not
shown). spo6-S is markedly accumulated after entry into
meiosis, while spo6-L is constitutively produced at very
low level (Fig. 3A). These results strongly suggest that
spo6-S is responsible for the spo6‡ activity, although the
472
Genes to Cells (2000) 5, 463-479
possibility that spo6-L plays some physiological roles
could not be completely excluded.
The predicted amino acid sequence of Spo6p
resembles S. cerevisiae Dbf4p and S. pombe Dfp1p,
which are regulatory subunits of the Cdc7 family
kinases. Both Dbf4p-Cdc7p and Dfp1p-Hsk1p are
implicated in DNA replication in the mitotic cell cycle
(Hartwell 1971; Kitada et al. 1992; Masai et al. 1995;
Bousset & Dif¯ey 1998; Brown & Kelly 1998;
Donaldson et al. 1998). The C-terminal region of
Spo6p shares a high degree of homology with the
corresponding region of Dfp1p, named motif-C, which
is supposed to be necessary for the interaction with a
kinase catalytic subunit (Takeda et al. 1999; Kumagai
et al. 1999). Thus, we have supposed that Spo6p forms a
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
Figure 7 Effect of caffeine on meiotic nuclear division in wild-type and spo6D strains. Mid-log phase cultures of diploid cells of wildtype (NT3-CH) and spo6D (NT2-JY) were incubated for 24 h in MML±N sporulation medium containing various concentrations of
caffeine. To assess meiotic division, ®xed cells were stained with DAPI. Open and ®lled columns indicate the percentage of cells which
completed meiosis-I and meiosis-II, respectively. More than 200 cells were counted for each sample.
Figure 8 Spindle microtubules of cells during meiosis-II visualized by immuno¯uorescence microscopy. Diploid cells of wild-type,
NT3-CH and those of spo6D, NT2-JY were incubated in MML±N sporulation medium, then were sampled and ®xed. Indirect
immuno¯uorescence microscopy was conducted using an anti-a-tubulin antibody, TAT-1, to visualize microtubules. Nuclear
chromatin regions were stained with DAPI.
q Blackwell Science Limited
Genes to Cells (2000) 5, 463±479
473
T Nakamura et al.
complex with Hsk1p and regulates its kinase activity in
premeiotic S-phase. spo6D cells, however, completed
premeiotic DNA replication (Fig. 5) and we could not
demonstrate the association of Spo6p with Hsk1p by
the two-hybrid assay. Furthermore, the ectopic expression experiments in spo6 or dfp1 disruptants showed that
Spo6p and Dfp1p were not interchangeable. In fact,
Hsk1p-Dfp1p was found to be indispensable for
premeiotic DNA replication (H. Masai, personal
communication). Thus, it seems likely that Spo6p
forms a complex with yet an unknown Cdc7 family
kinase rather than Hsk1 kinase, regulating the catalytic
activity of its partner kinase. We speculate that Spo6p
brings the partner kinase to the nuclei and activates its
kinase activity at an appropriate time in the course of
meiosis and sporulation. We recently isolated and
analysed a gene encoding another Cdc7-related protein
(T. Nakamura, T. Nakamura, M. Kubo & C. Shimoda,
unpublished result). This gene was identical to spo4
which had been genetically identi®ed by Bresch et al.
(1968). Characterization of Spo4p as a partner kinase of
Spo6p is now in progress.
Microscopic observation showed that the formation
and function of meiosis-II spindles are abnormal in
spo6D. One of the targets of a putative Spo6-associated
kinase might be regulatory proteins of meiosis-II
spindles. However, any spindle regulators which are
speci®c to meiosis-II have not been identi®ed to date.
We have noticed that spo6D cells are completely
defective in ascospore formation, irrespective of their
meiotic arrest points. Morphogenesis for sporulation is
triggered by structural modi®cation of SPB during
meiosis-II, i.e. a few layers of electron-dense outerplaques are developed outside the modi®ed SPBs
(Hirata & Tanaka 1982; Tanaka & Hirata 1982).
Membranous vesicles then gather and fuse near the
modi®ed SPBs to assemble forespore membranes,
which eventually engulf individual haploid nuclei.
Therefore, at this stage of sporulation, SPBs direct
two key events, namely spindle formation and the
initiation of forespore membrane assembly. A previous
electron microscopic study (Hirata & Shimoda 1992)
revealed that SPBs did not persist on the nuclear
membrane after meiosis-II in spo6 mutants and that
development of the forespore membrane was interrupted. This observation suggests that Spo6p is required
for the meiosis-II-speci®c functions of SPBs. The
absence of functional Spo6p may result in abnormal
forespore membranes on one side, and insuf®cient
spindle formation on the other.
One of the prominent features of meiosis is the
skipping of the S phase after the meiotic ®rst division.
474
Genes to Cells (2000) 5, 463-479
The repression mechanism of DNA replication
between two meiotic divisions has not been fully
understood. Ding et al. (2000) reported that DNA
polymerase a transiently accumulated in nucleus just
after meiosis-I. It is an attractive hypothesis that Spo6p
is implicated in the mechanism by which DNA
replication is inhibited during this `pseudo S phase',
although the spo6 deletion itself did not induce ectopic
DNA replication (cf. Figure 5).
The S. cerevisiae CDC7 is also required for meiosis
(Schild & Byers 1978). In contrast to spo6 mutants, cdc7
mutants are defective in synaptonemal complex formation and in commitment to genetic recombination
(Buck et al. 1991). These facts indicate that S. cerevisiae
Cdc7-Dbf4 kinase is also necessary for meiosis, while its
primary action might be different from that of Spo6passociated kinase. DBF4 is a sole gene encoding Dbf4
family proteins in the S. cerevisiae genome. In S. pombe,
the different cellular functions, DNA replication and
meiotic divisions, might be assigned to two different
Dbf4 homologues, Dfp1p and Spo6p, respectively.
Experimental procedures
Yeast strains and culture conditions
The S. pombe strains used in this study are listed in Table 1. Cells
were grown on YEA complete medium, or SD, EMM2 and
MMA minimal media (Gutz et al. 1974; Moreno et al. 1990).
YEL is a liquid version of YEA. Mating and sporulation were
induced on a malt-extract agar medium, MEA, or a synthetic
sporulation media, SSA (Gutz et al. 1974; Moreno et al. 1990).
Synchronous meiosis was attained basically according to Egel
& Egel-Mitani (1974). Diploid cells cultured in MML or SSL
minimal medium until a mid- or late-log phase were transferred
to SSL or MML lacking aspartic acid and ammonium sulphate
(SSL±N or MML±N) at a cell density of 1 ´ 107 cells/mL, and
then shaken at 30 8C. Yeast transformation was carried out by
means of a highly ef®cient lithium acetate method (Okazaki et al.
1990).
Flowcytometry
Flowcytometric analysis for DNA content was performed
according to the method of Costello et al. (1986) using the
FACScan (Becton-Dickinson). S. pombe cells were ®xed in 70%
ethanol, treated with RNase A, and then stained with propidium
iodide.
Cloning of spo6‡
A homothallic spo6 mutant strain, C186-6B (see Table 1), was
transformed by an S. pombe genomic library containing partial
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
Table 1 List of S. pombe strains used in this study
Strains
Haploid strains
L968
SG168
JY878
C186-6B
NT-1D
INT7
Diploid strains
C525
CD16-1
NT-1J
NT-4A
NT2-JY
NT3-CH
Genotypes
Source
h90
h leu1
h90 ade6-M216 ura4-D18 leu1
h90 spo6-B79 ade6-M210 leu1 ural
h90 ade6-M210 ura4-D18 leu1 spo6::ura4‡
h spo6‡::spo6‡/LEU2 leu1
U. Leupold
H. Gutz
M. Yamamoto
C. Shimoda
This study
This study
h90/h90 ade6-M216/ade6-M210 ura4-D18/ura4-D18 leu1/leu1
h‡/h ade6-M216/ade6-M210
h90/h90 ade6-M216/ade6-M210 ura4-D18/ura4-D18 leu1/leu1 ‡/spo6::ura4‡
h90/h90 ade6-M216/ade6-M210 ura4-D18/ura4-D18 leu1/leu1 spo6::ura4‡/spo6::ura4‡
h‡S/h ade6-M216/ade6-M210 ura4-D18/ura4-D18 leu1/leu1 spo6::ura4‡/spo6::ura4‡
h‡S/h ade6-M216/ade6-M210 leu1/leu1
C. Shimoda
C. Shimoda
This study
This study
This study
This study
HindIII fragments (Shimoda & Uehira 1985) constructed in a
multicopy plasmid, pDB2480 (Beach & Nurse 1981). The Leu‡
transformants (,105 clones) were sporulated on SSA plates, and
then treated with 30% ethanol for 30 min at 20 8C to kill
nonsporulated vegetative cells. Cells were then spread on SSA
medium. After the plates had been exposed to iodine vapour
(Gutz et al. 1974), colonies which turned brown were removed as
Spo‡ candidates. From one such sporulation-pro®cient and
Leu‡ transformant, plasmids were transferred to E. coli cells
(DH5). The isolated plasmid named pDB(spo6)1 contained a 4.3kb HindIII fragment. The restriction map is shown in Fig. 1A.
Subcloning experiments localized the spo6-complementing
activity on a 2.6-kb HindIII/BglII fragment (Fig. 1A).
To demonstrate whether the cloned DNA insert contained the
spo6‡ gene itself, or a multicopy suppressor of the spo6 mutation,
integration mapping was conducted. An integration vector
YIp32(LEU2), which carries the 4.3-kb HindIII fragment, was
integrated into an h spo6‡ strain, SG168. The integrant strain
INT7 was crossed to C186-6B harbouring the spo6-B79 allele.
The hybrid diploid strain was subjected to tetrad analysis, which
showed a regular 2 Spo‡: 2 Spo segregation and no
recombination occurred between spo6 and LEU2 loci among
Table 2 Spindle formation during meiosis-I and -II in spo6D cells
Binucleate cells of
different cell type (%)²
Cell type (%)
Culture
condition
Relevant
genotype*
Time
Mononucleate
Binucleate
Tetranucleate
30 8C
WT
spo6D
spo6D
5.5 h
5.5 h
10 h
44
52
23
34
48
71
22
1
6
7
2
0
51
71
69
3
1
6
39
25
24
20 8C
WT
spo6D
spo6D
14 h
14 h
21 h
31
43
27
36
57
73
33
0
0
3
8
1
59
92
96
1
0
2
37
0
2
10 mM
caffeine
(30 8C)
WT
spo6D
spo6D
5.5 h
5.5 h
10 h
80
81
35
12
18
65
8
1
0
2
2
0
60
98
86
1
0
6
37
0
8
*Diploid strains used: NT3-CH (wild-type) and NT2-JY (spo6D/spo6D).
²About 200 cells were observed.
q Blackwell Science Limited
Genes to Cells (2000) 5, 463±479
475
T Nakamura et al.
Table 3 Spindle length and separation of sister nuclei during meiosis-I and meiosis-II in spo6D
Mean length with SD (mm)²
Meiosis-I
Meiosis-II
Relevant
genotype*
Class-A
Class-B
Class-C
Class-D
Length of spindles (LS)
WT
spo6D
3.5 6 0.7
3.6 6 0.7
6.7 6 1.4
6.8 6 1.7
1.9 6 0.5
2.7 6 0.9³
4.4 6 1.1
3.8 6 0.9
Distance between sister nuclei (DN)
WT
spo6D
±
±
4.3 6 1.6
4.5 6 1.9
±
±
3.2 6 1.1
1.9 6 0.7³
Ratio
DN/LS
WT
spo6D
±
±
0.65
0.66
±
±
0.72
0.45
*Diploid strains used: NT3-CH(wild-type) and NT2-JY (spo6D/spo6D).
²About 200 cells were observed.
³P < 0.01 (t-test).
63 asci. This genetic data showed that the cloned insert contained
the spo6‡ gene.
Gene disruption of spo6‡
The Dspo6::ura4‡ null allele was produced by one-step gene
replacement (Rothstein 1983). A 1.1-kb ClaI fragment was
replaced by a 1.6-kb ura4‡ cassette (Grimm et al. 1988), and the
4.8-kb HindIII fragment bearing the Dspo6::ura4‡ allele was
transformed into a diploid strain, C525 (Fig. 1A). Some of the
stable Ura‡ transformants were sporulated and tetrad-dissected.
The ura4 marker segregation was regular, and the ura4‡
segregants exhibited sporulation-defective phenotype. Disruption was also con®rmed by genomic Southern hybridization
using the 4.3-kb HindIII fragment as a probe (Fig. 1B).
DNA sequencing
The 2.6-kb HindIII/BglII fragments were inserted into plasmids
pUC118/119 (Vieira & Messing 1987) and nucleotide sequences
were determined using the dideoxy chain termination method
(Sanger et al. 1977; Yanisch-Perron et al. 1985). The nucleotide
sequence was then analysed with the GENETYX software package
(SDC Co. Ltd, Tokyo).
Southern and Northern blotting
Total genomic DNA was prepared from S. pombe spheroplasts
(Hereford et al. 1979). DNA was restricted, fractionated on a
0.8% agarose gel and then transferred on to a nylon membrane
(Biodyne A, Nihon Pall Co., Tokyo). Total RNA was prepared
from S. pombe cultures (Jensen et al. 1983), and polyadenylated
[poly(A)‡] RNA was puri®ed by oligo(dT)-cellulose column
chromatography. poly(A)‡ RNA was fractionated on a 1.5% gel
476
Genes to Cells (2000) 5, 463-479
containing 3.7% formaldehyde as previously reported (Thomas
1980). Radioactive probes for Southern and Northern hybridization were prepared by either nick-translation (Rigby et al.
1977) or the random primer method (Feinberg & Vogelstein
1983).
cDNA synthesis and RT(reverse
transcription)-PCR
Total RNA was denatured at 65 8C for 10 min and used as a
template for reverse transcription. A commercial cDNA
synthesis kit was used (Pharmacia Biotech). To test splicing,
regions spanning each of the three introns were ampli®ed by
PCR using cDNA as well as three different sets of primers. Oligonucleotides used were: 50 ATGGCTCTCCCACCCACTG 30 and
50 AGTACATCATTCGGCTGGCA 30 for the ®rst intron;
50 CACCAGGACTACCGACCCAG 30 and 50 ACCAGGCTATCAGAGTTGAG 30 for the second intron; and 50 CTGCTGTGAGAGATACAAGGACTT 30 and 50 TTTGTCCGAATTGGGCGTCG 30 for the third intron.
Determination of 50 and 30 ends of spo6
mRNA
The RACE (rapid ampli®cation of cDNA ends) method was
conducted to determine 50 and 30 ends of the spo6 mRNA using a
commercial kit (Clontech) (Chenchik et al. 1996). cDNA was
synthesized and an adaptor DNA was ligated at both 50 and 30
termini according to the manufacturer's instruction. The 50 - and
30 -RACE fragments were ampli®ed using the spo6 primers,
50 GATGCGGCCGCCATTTGTCCGAATTGGGCG 30 and
50 GCCGGATCCCATGGCTCTCCCACCCACT 30 , as well
as an adaptor primer of the kit. The 50 and 30 end fragments were
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
electrophoresed on 1% agarose gel and the major fragments were
cloned and sequenced.
Immuno¯uorescence microscopy
Diploid cells incubated in MML±N sporulation medium were
harvested at intervals on glass discs (Whatman GF/C) by
®ltration. Collected cells were then ®xed with 99% methanol
at 80 8C for 8 min, treated with 0.1 mg/mL of Zymolyase100T (Kirin Brewing Co.), and resuspended in PEMS (100 mM
PIPES, 1 mM EGTA, 1 mM MgSO4, 1 M sorbitol) containing 1%
Triton X-100. Microtubules were visualized by indirect
immuno¯uorescence microscopy using the anti-a-tubulin
monoclonal antibody TAT-1 (Woods et al. 1989) and antimouse Cy3-conjugated immunoglobulin (Molecular Probe Co.)
as a secondary antibody. To visualize the nuclear chromatin
region, samples were stained with 40 ,6-diamidino-2-phenylindole (DAPI) at 1 mg/mL. Stained cells were observed under a
¯uorescence microscope (Olympus BX-50).
Over-expression of Spo6p
The spo6 cDNA sequence was ampli®ed by RT-PCR using Taq
polymerase (Takara Shuzo Co.) and a set of oligonucleotide
primers, GCCGGATCC(BamHI)GCATGGCTCTCCCACCCACTG and CGCGGATCC(BamHI)TTAATTTGTCCGAATTGGGCG. The PCR product was digested with BamHI and
inserted into a vector plasmid pREP1 (Maundrell 1993), named
pREP(spo6). The expression was driven by the thiaminerepressible nmt1 promoter. In the absence of thiamine, the
sporulation-de®cient phenotype of spo6 mutants was completely
suppressed (data not shown).
Construction of the GFP-Spo6 fusion gene
Two types of fusion genes encoding the green ¯uorescent
protein (GFP) and Spo6p were constructed. The spo6 cDNA
coding region was ampli®ed by RT-PCR using Taq
polymerase (Takara Shuzo Co.) and a pair of oligonucleotides,
50 GGGCCCGGATCC(BamHI)ATGGCTCTCCCACCCACT 30 and 50 GTGCACGATATC(EcoRV)TTAATTTGTCCGAATTGG 30 . The PCR product was digested with BamHI and
EcoRV and then inserted into the plasmid pREP41-GFPS65T at
the BamHI and SmaI sites downstream of a mutant version of
GFPS65T. In this plasmid, named pREP41(GFP-Spo6), the
expression of the fusion gene was driven by the nmt1 promoter
(Fig. 4B).
To construct the spo6-GFP fusion gene whose transcription
was driven by the native spo6 promoter, a genomic DNA stretch
between the internal BglII site and the end of the ORF was
ampli®ed by PCR with a pair of oligonucleotides, TGGAGAGATCT(BglII)TATGGCCAAGTCTTGCTAT and GATGCGGCCGC(NotI)CATTTGTCCGAATTGGGCG.
The
PCR product was digested with BglII and NotI and then inserted
into a plasmid pAL(spo6), which contained the full length of
q Blackwell Science Limited
spo6‡ (Horie et al. 1998), at the BglII site in the spo6 ORF and
NotI site of multicloning sites. The thus constructed plasmid was
then digested with NotI and SacI and the NotI/SacI fragment
containing GFPS65T was inserted. This plasmid named
pAL(Spo6-GFP) contained the fusion gene which encodes the
GFP protein fused to the C terminus of Spo6p (Fig. 4A).
Two-hybrid analysis
The BamHI fragment containing the uninterrupted spo6 ORF
was excised from pREP(spo6) and then inserted into the BamHI
site of the pGAD424 (Clontech). This plasmid named pGAD
(spo6) expressed the Gal4 activation domain-Spo6 fusion protein.
The hsk1‡ gene fused with the GAL4 DNA-binding domain,
named pAS(hsk1), was kindly provided by Dr H. Masai
(University of Tokyo). A recipient strain of S. cerevisiae, Y190,
was co-transformed with pGAD(spo6) and pAS(hsk1). Transformants were grown on nylon membranes (Biodyne B, 0.45 mm;
PALL Co.) which were placed on SD plates at 30 8C for 2±3 days.
The ®lters were then frozen in liquid nitrogen and incubated
with X-Gal to detect b-galactosidase activity.
Nucleotide sequence accession number
The nucleotide sequence of the spo6‡ gene appears in the
EMBL, GENBANK, and DDBJ databases with accession No.
AB020809.
Acknowledgements
We are grateful to Dr H. Masai, University of Tokyo, for the hsk1
plasmid for the two-hybrid assay and also for communicating
unpublished results, to Dr K. Gull, University of Manchester, for
the TAT-1 antibody, to Dr Y. Hiraoka, Kansai Advanced
Research Center, for stimulating discussions and for the
GFPS65T plasmid and communicating unpublished results. We
also thank Dr Taro Nakamura and Mr M. Shimoseki, Osaka City
University, for invaluable discussions and technical assistance.
This study was supported by Grants-in-Aid for Scienti®c
Research on Priority Areas from the Ministry of Education,
Science, Sports and Culture of Japan to C. S.
References
Abe, H. & Shimoda, C. (2000) Autoregulatory expression of
Schizosaccharomyces pombe meiosis-speci®c transcription factor
Mei4 and a genome-wide search for its target genes. Genetics,
154, 1497±1508.
Beach, D. & Nurse, P. (1981) High-frequency transformation of
the ®ssion yeast Schizosaccharomyces pombe. Nature 290,
140±142.
Bousset, K. & Dif¯ey, J.F. (1998) The Cdc7 protein kinase is
required for origin ®ring during S phase. Genes Dev. 12,
480±490.
Bresch, C., Muller, G. & Egel, R. (1968) Genes involved in
meiosis and sporulation of a yeast. Mol. Gen. Genet. 102,
301±306.
Genes to Cells (2000) 5, 463±479
477
T Nakamura et al.
Brown, G.W. & Kelly, T.J. (1998) Puri®cation of hsk1, a
minichromosome maintenance protein kinase from ®ssion
yeast. J. Biol. Chem. 273, 22083±22090.
Brown, G.W. & Kelly, T.J. (1999) Cell cycle regulation of Dfp1,
an activator of the Hsk1 protein kinase. Proc. Natl. Acad. Sci.
USA 96, 8443±8448.
Buck, V., White, A. & Rosamond, J. (1991) CDC7 protein
kinase activity is required for mitosis and meiosis in
Saccharomyces cerevisiae. Mol. Gen. Genet. 227, 452±457.
Chapman, J.W. & Johnston, L.H. (1989) The yeast gene, DBF4,
essential for entry into S phase is cell cycle regulated. Exp. Cell
Res. 180, 419±428.
Chenchik, A., Moqadam, F. & Siebert, P. (1996) A new method
for full-length cDNA cloning by PCR. In: A Laboratory Guide
to RNA: Isolation, Analysis, and Synthesis (ed. P.A. Krieg),
pp. 273±321. Wiley-Liss, Inc.
Cheng, L., Collyer, T. & Hardy, C.F. (1999) Cell cycle regulation
of DNA replication initiator factor Dbf4p. Mol. Cell. Biol. 19,
4270±4278.
Costello, G., Rodgers, L. & Beach, D. (1986) Fission yeast enters
the stationary phase G0 state from either mitotic G1 or G2.
Curr. Genet. 11, 119±125.
Ding, D.-Q., Tomita, Y., Yamamoto, A., Chikashige, Y.,
Haraguchi, T. & Hiraoka, Y. (2000) Large-scale screening of
intracellular protein localization in living ®ssion yeast cells by
the use of a GFP-fusion genomic DNA library. Genes Cells
5, 169±190.
Donaldson, A.D., Fangman, W.L. & Brewer, B.J. (1998) Cdc7 is
required throughout the yeast S phase to activate replication
origins. Genes Dev. 12, 491±501.
Dowell, S.J., Romanowski, P. & Dif¯ey, J.F. (1994) Interaction of
Dbf4, the Cdc7 protein kinase regulatory subunit, with yeast
replication origins in vivo. Science 265, 1243±1246.
Egel, R. (1971) Physiological aspects of conjugation in ®ssion
yeast. Planta (Berl.) 98, 89±96.
Egel, R. (1977) Selective spore survival during replica-plating of
®ssion yeast. Arch. Microbiol. 112, 109±110.
Egel, R. (1989) Mating-type genes, meiosis, and sporulation. In:
Molecular Biology of the Fission Yeast (eds A. Nasim, P. Young &
B.F. Johnson), pp. 31±73. New York: Academic press.
Egel, R. & Egel-Mitani, M. (1974) Premeiotic DNA synthesis in
®ssion yeast. Exp. Cell Res. 88, 127±134.
Esposite, R.E. & Klapholz, S. (1981) Meiosis and ascospore
development. In: The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance (eds J.N. Strathern, E.W. Jones
& J.R. Broach), pp. 211±287. Cold Spring Harbor, New York:
Cold Spring Harbor Laboratory Press.
Feinberg, A.P. & Vogelstein, B. (1983) A technique for
radiolabeling DNA restriction endonuclease fragments to
high speci®c activity. Anal. Biochem. 132, 6±13.
Ferreira, M.G., Santocanale, C., Drury, L.S. & Dif¯ey, J.F.X.
(2000) Dbf4p, an essential S phase-promoting factor, is
targeted for degradation by the anaphase-promoting complex.
Mol. Cell. Biol. 20, 242±248.
Grimm, C., Kohli, J., Murray, J. & Maundrell, K. (1988) Genetic
engineering of Schizosaccharomyces pombe: a system for gene
disruption and replacement using the ura4 gene as a selectable
marker. Mol. Gen. Genet. 215, 81±86.
Gutz, H., Heslot, H., Leupold, U. & Loprieno, N. (1974)
Schizosaccharomyces pombe. In: Handbook of Genetics, Vol. 1 (ed.
R.C. King), pp. 395±446. New York: Plenum Press.
Hartwell, L.H. (1971) Genetic control of the cell cycle in yeast.
478
Genes to Cells (2000) 5, 463-479
II. Genes controlling DNA replication and its initiation. J. Mol.
Biol. 59, 183±194.
Hereford, L., Fahrner, J., Woolford, K., JrRosbash, M. &
Kaback, D.B. (1979) Isolation of yeast histone genes H2A and
H2B. Cell 18, 1261±1271.
Hirata, A. & Shimoda, C. (1992) Electron microscopic
examination of sporulation-de®cient mutants of the ®ssion
yeast Schizosaccharomyces pombe. Arch. Microbiol. 158, 249±255.
Hirata, A. & Shimoda, C. (1994) Structural modi®cation of
spindle pole bodies during meiosisII is essential for the normal
formation of ascospores in Schizosaccharomyces pombe: Ultrastructural analysis of spo mutants. Yeast 10, 173±183.
Hirata, A. & Tanaka, K. (1982) Nuclear behavior during
conjugation and meiosis in the ®ssion yeast Schizosaccharomyces
pombe. J. Gen. Appl. Microbiol. 28, 263±274.
Horie, S., Watanabe, Y., Tanaka, K., et al. (1998) The
Schizosaccharomyces pombe mei4‡ gene encodes a meiosisspeci®c transcription factor containing a forkhead DNAbinding domain. Mol. Cell. Biol. 18, 2118±2129.
Jackson, A.L., Pahl, P.M., Harrison, K., Rosamond, J. & Sclafani,
R.A. (1993) Cell cycle regulation of the yeast Cdc7 protein
kinase by association with the Dbf4 protein. Mol. Cell. Biol.
13, 2899±2908.
Jensen, R., Sprague, G.F. Jr & Herskowitz, I. (1983) Regulation
of yeast mating-type interconversion: feedback control of HO
gene expression by the mating-type locus. Proc. Natl. Acad. Sci.
USA 80, 3035±3039.
Kishida, M., Nagai, T., Nakaseko, Y. & Shimoda, C. (1994)
Meiosis-dependent mRNA splicing of the ®ssion yeast
Schizosaccharomyces pombe mes1‡ gene. Curr. Genet. 25,
497±503.
Kishida, M. & Shimoda, C. (1986) Genetic mapping of eleven
spo genes essential for ascospore formation in the ®ssion yeast
Schizosaccharomyces pombe. Curr. Genet. 10, 443±447.
Kitada, K., Johnston, L.H., Sugino, T. & Sugino, A. (1992)
Temperature-sensitive cdc7 mutations of Saccharomyces cerevisiae
are suppressed by the DBF4 gene, which is required for the
G1/S cell cycle transition. Genetics 131, 21±29.
Kumagai, H., Sato, N., Yamada, M., et al. (1999) A novel
growth- and cell cycle-regulated protein, ASK, activates
human Cdc7-related kinase and is essential for G1/S transition
in mammalian cells. Mol. Cell. Biol. 19, 5083±5095.
Lei, M., Kawasaki, Y., Young, M.R., et al. (1997) Mcm2 is a
target of regulation by Cdc7-Dbf4 during the initiation of
DNA synthesis. Genes Dev. 11, 3365±3374.
Masai, H., Miyake, T. & Arai, K. (1995) hsk1‡, a Schizosaccharomyces pombe gene related to Saccharomyces cerevisiae
CDC7, is required for chromosomal replication. EMBO J. 14,
3094±3104.
Maundrell, K. (1993) Thiamine-repressible expression vectors
pREP and pRIP for ®ssion yeast. Gene 123, 127±130.
Moreno, S., Klar, A. & Nurse, P. (1990) Molecular genetic
analysis of ®ssion yeast Schizosaccharomyces pombe. Meth.
Enzymol. 194, 793±823.
Nederlof, P.M., Wang, H.-R. & Raumeister, W. (1995) Nuclear
localization signals of human and Thermoplasma proteasomal a
subunits are functional in vitro. Proc. Natl. Acad. Sci. USA 92,
12060±12064.
Ohkura, H., Adachi, Y., Kinoshita, N., et al. (1988) Coldsensitive and caffeine-supersensitive mutants of the Schizosaccharomyces pombe dis genes implicated in sister chromatid
separation during mitosis. EMBO J. 7, 1465±1473.
q Blackwell Science Limited
Meiotic function of Dbf4-like protein in yeast
Okazaki, K., Okazaki, N., Kume, K., et al. (1990) Highfrequency transformation method and library transducing
vectors for cloning mammalian cDNAs by trans-complementation of Schizosaccharomyces pombe. Nucl. Acids Res. 18,
6485±6489.
Olson, L.W., Eden, U., Egel-Mitani, M. & Egel, R. (1978)
Asynaptic meiosis in ®ssion yeast? Hereditas 89, 189±199.
Oshiro, G., Owens, J.C., Shellman, Y., Sclafani, R.A. & Li, J.J.
(1999) Cell cycle control of Cdc7p kinase activity through
regulation of Dbf4p stability. Mol. Cell. Biol. 19, 4888±4896.
Rigby, P.W., Dieckmann, M., Rhodes, C. & Berg, P. (1977)
Labeling deoxyribonucleic acid to high speci®c activity in
vitro by nick translation with DNA polymerase I. J. Mol. Biol.
113, 237±251.
Rothstein, R.J. (1983) One-step gene disruption in yeast. Meth.
Enzymol. 101, 202±211.
Russell, P. (1989) Gene cloning and expression in ®ssion yeast.
In: Molecular Biology of The Fission Yeast (eds A. Nasim, P. Young
& B.F. Johnson), pp. 243±271. New York: Academic press.
Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA
74, 5463±5467.
Schild, D. & Byers, B. (1978) Meiotic effects of DNA-defective
cell division cycle mutations of Saccharomyces cerevisiae.
Chromosoma 70, 109±130.
Shimoda, C., Hirata, A., Kishida, M., Hashida, T. & Tanaka, K.
(1985) Characterization of meiosis-de®cient mutants by
electron microscopy and mapping of four essential genes in
the ®ssion yeast Schizosaccharomyces pombe. Mol. Gen. Genet.
200, 252±257.
Shimoda, C. & Uehira, M. (1985) Cloning of the Schizosaccharomyces pombe mei3 gene essential for the initiation of meiosis.
Mol. Gen. Genet. 201, 353±356.
Takeda, T., Imai, Y. & Yamamoto, M. (1989) Substitution at
q Blackwell Science Limited
position 116 of Schizosaccharomyces pombe calmodulin decreases
its stability under nitrogen starvation and results in a
sporulation-de®cient phenotype. Proc. Natl. Acad. Sci. USA
86, 9737±9741.
Takeda, T., Ogino, K., Matsui, E., et al. (1999) A ®ssion yeast
gene, him1‡/dfp1‡, encoding a regulatory subunit for
hsk1 kinase, plays essential roles in S-phase initiation as well
as in S-phase checkpoint control and recovery from DNA
damage. Mol. Cell. Biol. 19, 5535±5547.
Tanaka, K. & Hirata, A. (1982) Ascospore development in the
®ssion yeasts Schizosaccharomyces pombe and S. japonicus. J. Cell
Sci. 56, 263±279.
Thomas, P.S. (1980) Hybridization of denatured RNA and small
DNA fragments transferred to nitrocellulose. Proc. Natl. Acad.
Sci. USA 77, 5201±5205.
Vieira, J. & Messing, J. (1987) Production of single-stranded
plasmid DNA. Meth. Enzymol. 153, 3±11.
Woods, A., Sherwin, T., Sasse, R., et al. (1989) De®nition of
individual components within the cytoskeleton of Trypanosoma
brucei by a library of monoclonal antibodies. J. Cell Sci. 93,
491±500.
Yamamoto, M., Imai, Y. & Watanabe, Y. (1997) Mating and
sporulation in Schizosaccharomyces pombe. In: Molecular and
Cellular Biology of the Yeast Saccharomyces (eds J.R. Pringle, J.B.
Broach & E.W. Jones), pp. 1037±1110. Cold Spring Harbor,
New York: Cold Spring Harbor Laboratory Press.
Yanisch-Perron, C., Vieira, J. & Messing, J. (1985) Improved
M13 phase cloning vectors and host strains: nucleotide
sequences of the M13mp18 and pUC19 vectors. Gene 33,
103±119.
Received: 27 October 1999
Accepted: 29 February 2000
Genes to Cells (2000) 5, 463±479
479